Skip to main content

Advertisement

Table 1 Sequences of primer and probes of quantitative RT-PCR

From: Folic acid and melatonin ameliorate carbon tetrachloride-induced hepatic injury, oxidative stress and inflammation in rats

Primer Sequence
Fas F: CTGCCTCTGGTGCTTGCTGGC
  R: ACCCCACCCCCTTCTCCCAATTC
AKt1 F: ACGCCGCCTGATCAAGTTCTCC
  R: TGACGGACAGCGGGAGAGGG
IFN-γ F: TCTGGGCTTCTCCTCCTGCGG
  R: GGCGCTGGACCTGTGGGTTG
TNF-α F: GCGGAGTCCGGGCAGGTCTA
  R: GGGGGCTGGCTCTGTGAGGA