Skip to main content

Advertisement

Table 1 Characteristics of primers used for qPCR

From: Carnitine supplementation to obese Zucker rats prevents obesity-induced type I to type II muscle fiber transition and favors an oxidative phenotype of skeletal muscle

Gene symbol Primer sequence (forward, reverse; from 5′ to 3′) NCBI GeneBank Product size (bp) Slope R2# Efficiency*
(HUGO)
ACADL AAGGATTTATTAAGGGCAAGAAGC NM_012819 380 bp -3.88 0.998 1.81
GGAAGCGGAGGCGGAGTC
ACADM CAAGAGAGCCTGGGAACTTG NM_016986 154 bp -3.38 0.999 1.98
CCCCAAAGAATTTGCTTCAA
ATP5B GCACCGTCAGAACTATTGCT NM_134364 203 bp -3.59 0.999 1.90
GAATTCAGGAGCCTCAGCAT
CANX CCAGATGCAGATCTGAAGAC NM_172008 175 bp -2.75 0.999 2.31
CTGGGTCCTCAATTTCACGT
CD36 TCGTATGGTGTGCTGGACAT NM_031561 358 bp -3.28 0.996 2.02
GGCCCAGGAGCTTTATTTTC
CPT1B GCAAACTGGACCGAGAAGAG NM_013200 180 bp -3.32 0.988 2.00
CCTTGAAGAAGCGACCTTTG
FABP3 ACCATCCACTGCCGTCTTAC NM_013177 310 bp -3.20 0.957 2.05
CCCCGATGCGTAGGTATTCT
HK2 GATGGAATCGAGAAGGCCTA, NM_012735 220 bp -3.63 1.000 1.89
GTTTCTTGTAGACGGAGCCA
LPL GAGATTTCTCTGTATGGCACA NM_012598 276 bp -3.34 0.992 1.99
CTGCAGATGAGAAACTTTCTC
MDH1 CAGACAAAGAAGAGGTTGCC, NM_033235 206 bp -3.40 0.994 1.97
CGTCAGGCAGTTTGTATTGG
MYH1 GCAGACTCTCCCACTGGGCTG NM_001135158 83 bp -3.16 0.953 2.07
GAGCAGCCTCCCCGAAAACGG
MYH2 GCTGATCGAAATGCTGCTGA NM_001135157 124 bp -3.38 0.990 1.98
GTCAATAGCACTATCCGTGG
MYH4 CCAGTCCATCCTGATTACTG NM_019325 74 bp -3.48 0.988 1.94
CAAAGTACTGGATGACACGC
MYH7 ATTGCCGAGTCCCAGGTCAACA NM_017240 127 bp -3.24 0.944 2.03
GCTCCAGGTCTCAGGGCTTCAC
PFKM TCCTGGTTGGCTCAATCGAC NM_031715 297 bp -3.75 0.998 1.85
TGTTGAGACGAGAACCACGG
PKM ACCTGGGCATTGAGATTCCG NM_053297 314 bp -3.69 0.997 1.87
TCGCGCAAGCTCTTCAAACA
PPARD GCAGAGCTATGACCAGGCCTGCA NM_013141 151 bp -3.29 0.990 2.01
GTGCTCTGGTCCCCCGTTGA
PPARGC1A CTCTTTGCCCAGATCTTCCT NM_031347 145 bp -3.93 0.999 1.80
ATGTTCGCGGGCTCATTGTT
PPARGC1B CATATAAGCCCATGGAGGAG NM_176075 476 bp -3.25 0.978 2.03
CAGCCCAAAGTGCTTTGTGA
RPL13 CTTAAATTGGCCACGCAGCT XR_086310 198 bp -3.48 0.998 1.94
CTTCTCAACGTCTTGCTCTG
SDHA TGGACCTTGTCGTCTTTGG NM_130428 88 bp -3.90 0.997 1.80
TTTGCCTTAATCGGAGGAAC
SLC2A4 GAGTTATGTGTCCATCGTGG NM_012751 187 bp -2.59 0.953 2.40
CGCAACATACTGGAAACCCA
SLC22A5 GAACTCACGAGCCTCGCACGC NM_019269 117 bp -3.75 0.997 1.85
TCGTCGTAGTCCCGCATGCC
SLC25A20 AGCCCACCTGTTATCCACTG NM_053965 178 bp -3.32 0.988 2.00
TGTGCAAAAAGAGCCTTCCT
SLC27A1 GTATCTGCTGGACCTTCGC NM_053580 243 bp -3.48 0.990 1.94
CATAAATGAGGGCCTTGGCA
TOP1 GAAGAACGCTATCCAGAAGG NM_022615 137 bp -3.33 0.997 2.00
GCTTTGGGACTCAGCTTCAT
UCP1 CAGGCTTCCAGTACTATTAGG NM_012682 181 bp -3.40 0.983 1.97
CTCTCCCTGAAGAGAAGTACT
UCP2 CAAGGAGAGAGTCAAGGGCTA NM_019354 209 bp -3.08 0.998 2.11
GACTCTGAGCCCTTGGTGTAG
UCP3 CTCGGTACCATCCTGACTAT NM_013167 149 bp -3.47 0.982 1.94
GTTCCTTTGGGGGTGTAGAA
VEGFA GTTCATGGACGTCTACCAGC NM_031836 253 bp -3.62 0.973 1.89
GCTATGCTGCAGGAAGCTCA
VEGFB GTGTCCCAGTTTGATGGCC NM_053549 187 bp -3.45 1.000 1.95
CGTCAGGACAGCAGCCAC
YWHAZ GACGGAAGGTGCTGAGAAA NM_013011 198 bp -3.13 0.986 2.09
GCAGCAACCTCAGCCAAGT
  1. #Coefficient of determination of the standard curve.
  2. *The efficiency is determined by [10(-1/-slope].