Skip to main content

Table 1 List of primers used to amplify the desired genes

From: Promotion of immune and glycaemic functions in streptozotocin-induced diabetic rats treated with un-denatured camel milk whey proteins

Primer name 5′——————— < 3′ Primer length
IL-2 Forward CCTGAGCAGGGAGAATTACA 20
Reverse TCCAGAACATGCCGCAGA 18
Fas Forward GAGAATTGCTGAAGACATGACAATCC 26
Reverse ATGGCTGGAACTGAGGTAGTTTTCAC 26
Akt1 Forward CCTTTATTGGCTACAAGGAACGG 23
Reverse GAAGGTGCGCTCAATGACTG 20
CD28 Forward GTATTCCTACAACCTTCTCGCAA 23
Reverse GGGGCTGATAGGTAAAATTCCCA 23
Cdc42 Forward TTCTGGTTGTGTTTCAACTGCT 22
Reverse CCTCCCTTGGACTGCATCTG 20
Inf- γ Forward GCCCAATATCTCGGATGCTTC 21
Reverse GCCAAAATAGCTTCGGTAATCCT 23
TNF-α Forward CCAACATGCTGATTGATGACACC 23
Reverse GAGAATGCCAATTTTGATTGCCA 23