Skip to main content

Advertisement

Table 1 Primer sequences

From: Embryonic viability, lipase deficiency, hypertriglyceridemia and neonatal lethality in a novel LMF1-deficient mouse model

Name Sequence Application
TG0048-3' AGGCTAAGACTCTTTAGGCTCAGG Genotyping
TG0048-5' GGCGAGACGATGCTAATTCTATTCC Genotyping
LTR2 AAATGGCGTTACTTAAGCTAGCTTGC Genotyping
KO-A CCGCTTTTCCTGAAGTGAAGGA Genotyping
T7-LMF1 GCCAGTAATACGACTCACTATAGGGATGCGCCCAGACAGCCTAGTA IVT
T3-LMF1 GCCAGAATTAACCCTCACTAAAGGGATCTGCAGCACTCCAT IVT
p1 ATGCGCCCAGACAGCCTAGT RT-PCR
p2 GAGAACCTGCGTGCAATCCAT RT-PCR
p3 CCCAGAGGGCAGTCATGA RT-PCR
p4 GGGCATCTCGTCCTTTGT RT-PCR
p5 GTGACCTGTGCAGGTAGT RT-PCR
p6 CGTGGAGCTTCTTGTGCCT qPCR
p7 GGATCTGCAGCACTCCAT qPCR
36B4-f CACTGGTCTAGGACCCGAGAAG qPCR
36B4-r GGTGCCTCTGGAGATTTTCG qPCR