Skip to main content

Advertisement

Table 1 Gene-specific primer used for Real Time RT-PCR assays

From: Reversal of High dietary fructose-induced PPARα suppression by oral administration of lipoxygenase/cyclooxygenase inhibitors

GenBank Accession Number Primer Sequence (5'→3') Amplicon Size (bp) Region of Gene (nt)
NM_013196 Rat PPARα 177  
  Forward TCACACAATGCAATCCGTTT   876–895
  Reverse GGCCTTGACCTTGTTCATGT   1052–1033
V01279 Rat 18S rRNA 133  
  Forward ATGGCCGTTCTTAGTTGGTG   1336–1355
  Reverse AACGCCACTTGTCCCTCTAA   1468–1449
  1. Primer sequences were designed using Primer Express software (Applied Biosystems) using sequences accessed through GenBank. Amplicon size and region of each gene are indicated.