Skip to main content

Table 1 Primer sequences and PCR parameters

From: Differential effects of curcumin on vasoactive factors in the diabetic rat heart

Gene Primers (5' → 3') Temperature*
Rat eNOS GCAAGACCGATTACACGACA
GTCCTCAGGAGGTCTTGCAC
Denaturation
Annealing
Extension
Signal
95°C-0 sec
57°C-5 sec
72°C-10 sec
85°C-1 sec
Human eNOS [42] CCTCCAGGAAGGAGCAAAC
TCCTGAGAGAGAGGCAAGAGGA
Denaturation
Annealing
Extension
Signal
95°C-0 sec
55°C-5 sec
72°C-8 sec
81°C-1 sec
Rat iNOS ATGGAACAGTATAAGCGAAACACC
GTTTCCGGTCGATGTCATGAGCAAAGG
Denaturation
Annealing
Extension
Signal
95°C-0sec
57°C-5 sec
72°C-10 sec
83°C-1 sec
Human iNOS [42] CCCCATCAAGCCCTTTACTT
CACCTCCTGGTGGTCACTT
Denaturation
Annealing
Extension
Signal
95°C-0 sec
55°C-5 sec
72°C-8 sec
81°C-1 sec
Rat ET-1 GCTCCTGCTCCTCCTTGATG
CTCGCTCTATGTAAGTCATGG
Denaturation
Annealing
Extension
Signal
95°C-0 sec
55°C-5 sec
72°C-20 sec
84°C-1 sec
Human ET-1 AAGCCCTCCAGAGAGCGTTAT
CCGAAGGTCTGTCACCAATGT
6FAM-TGACCCACAACCGAG-MGBNFQ
Denaturation
Annealing
Extension
Signal
95°C-0 sec
55°C-5 sec
72°C-4 sec
72°C-1 sec
Human HO-1 [43] TGATAGAAGAGGCCAAGA
TTTCCAGACAGAGGGACA
Denaturation
Annealing
Extension
Signal
95°C-0 sec
50°C-10 sec
72°C-17 sec
84°C-1 sec
Human HO-2 [43] TGGAGCGCAACAAGGACCAT
CCGGTAGAGCTGCTTGAACT
Denaturation
Annealing
Extension
Signal
95°C-0 sec
50°C-10 sec
72°C-17 sec
84°C-1 sec
β-actin CCTCTATGCCAACACAGTGC
CATCGTACTCCTGCTTGCTG
Denaturation
Annealing
Extension
Signal
95°C-0 sec
58°C-5 sec
72°C-8 sec
83°C-1 sec
  1. * Initial denaturation was carried out at 95 °C for 3 minutes.