Skip to main content

Table 1 Genes for cDNA standards and sequences of the primers used for their estimation.

From: Semiquantitative RT-PCR measurement of gene expression in rat tissues including a correction for varying cell size and number

Gene name Gene Direction Sequence Length
60S acidic ribosomal protein P0 Arbp 3' > 5' GAGCCAGCGAAGCCACACT 62
Cyclophilin A Ppia 3' > 5' CTGAGCACTGGGGAGAAAGGA 87
Carbohydrate-responsive element-binding protein Wbscr14 3' > 5' TACTGTTCCCTGCCTGCTCTCC 116
Type II iodothyronine deiodinase Dio2 3' > 5' CGGTGGCTGACTTCCTGTTG 123
Acetyl-CoA carboxylase 1 Acaca 3' > 5' AGGAAGATGGTGTCCGCTCTG 145
60S acidic ribosomal protein P0 Arbp 3' > 5' CCCTTCTCCTTCGGGCTGAT 165
Insulin receptor substrate 1 Irs1 3' > 5' AATGAGGGCAGCTCCCCAAG 198