Skip to main content

Advertisement

Table 1 Genes for cDNA standards and sequences of the primers used for their estimation.

From: Semiquantitative RT-PCR measurement of gene expression in rat tissues including a correction for varying cell size and number

Gene name Gene Direction Sequence Length
60S acidic ribosomal protein P0 Arbp 3' > 5' GAGCCAGCGAAGCCACACT 62
   5' > 3' GATCAGCCCGAAGGAGAAGG  
Cyclophilin A Ppia 3' > 5' CTGAGCACTGGGGAGAAAGGA 87
   5' > 3' GAAGTCACCACCCTGGCACA  
Carbohydrate-responsive element-binding protein Wbscr14 3' > 5' TACTGTTCCCTGCCTGCTCTCC 116
   5' > 3' ACTGCCCTTGTGGCTTGCTC  
Type II iodothyronine deiodinase Dio2 3' > 5' CGGTGGCTGACTTCCTGTTG 123
   5' > 3' CACATCGGTCCTCTTGGTTCC  
Acetyl-CoA carboxylase 1 Acaca 3' > 5' AGGAAGATGGTGTCCGCTCTG 145
   5' > 3' GGGGAGATGTGCTGGGTCAT  
60S acidic ribosomal protein P0 Arbp 3' > 5' CCCTTCTCCTTCGGGCTGAT 165
   5' > 3' TGAGGCAACAGTCGGGTAGC  
Insulin receptor substrate 1 Irs1 3' > 5' AATGAGGGCAGCTCCCCAAG 198
   5' > 3' GGTCCTGGTTGTGAATCGTGAA