Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Sets of primers for real-time PCR analysis

From: Expression of PPARα modifies fatty acid effects on insulin secretion in uncoupling protein-2 knockout mice

Primer Name Sequence
PPARα forward:
5'GGGCTCTCCCACATCCTT3'
reverse:
5'CCCATTTCGGTAGCAGGTAGTC3'
UCP2 [8] forward:
5'CAGCCAGCGCCCAGTACC3'
reverse:
5'CAATGCGGACGGAGGCAAAGC3'
GAPDH [8] forward:
5'GTGGCAGTGATGGCATGGAC3'
reverse:
5'CAGCACCAGTGGATGCAGGG3'
ACO [53] forward:
5'ATATTTACGTCACGTTTACCCCGG3'
reverse:
5'GGCAGGTCATTCAAGTACGACAC3'
CPT1 [50] forward:
5'TTCACTGTGACCCCAGACGG3'
reverse:
5'AATGGACCAGCCCCATGGAGA3'
MCD [54] forward:
5'TGTTCTGATGGGCCAGGCTTACTT3'
reverse:
5'TAGAGCTTTCTGAAGGCACAGGCT3'
ACC [55] forward:
5'TGGATCCGCTTACAGAGAGACTTTT3'
reverse:
5'GCCGGAGCATCTCATTCG3'