Skip to main content

Advertisement

Table 1 Sets of primers for real-time PCR analysis

From: Expression of PPARα modifies fatty acid effects on insulin secretion in uncoupling protein-2 knockout mice

Primer Name Sequence
PPARα forward: 5'GGGCTCTCCCACATCCTT3' reverse: 5'CCCATTTCGGTAGCAGGTAGTC3'
UCP2 [8] forward: 5'CAGCCAGCGCCCAGTACC3' reverse: 5'CAATGCGGACGGAGGCAAAGC3'
GAPDH [8] forward: 5'GTGGCAGTGATGGCATGGAC3' reverse: 5'CAGCACCAGTGGATGCAGGG3'
ACO [53] forward: 5'ATATTTACGTCACGTTTACCCCGG3' reverse: 5'GGCAGGTCATTCAAGTACGACAC3'
CPT1 [50] forward: 5'TTCACTGTGACCCCAGACGG3' reverse: 5'AATGGACCAGCCCCATGGAGA3'
MCD [54] forward: 5'TGTTCTGATGGGCCAGGCTTACTT3' reverse: 5'TAGAGCTTTCTGAAGGCACAGGCT3'
ACC [55] forward: 5'TGGATCCGCTTACAGAGAGACTTTT3' reverse: 5'GCCGGAGCATCTCATTCG3'