Skip to main content

Table 3 Assay DNA sequences for the SNPs analyzed.

From: Physiogenomic comparison of human fat loss in response to diets restrictive of carbohydrate or fat

SNP Gene Chr mac min maj Freq Sequence Context
rs694066 GAL 11 20 A G 0.09 TTCTAAGTCCTCTGCCATGCC [A/G]GGAAAGCCTGGGTGCACCCA
rs7602 LEPR 1 29 A G 0.16 CTTGGAGAGGCAGATAACGCT [A/G]AAGCAGGCCTCTCATGACCC
rs1171276 APOA4 1 23 A G 0.13 AGTTTCATGTACATTAAATAT [A/G]AATTTCTTTTGGCTGGAAAT
rs8179183 APOA4 1 31 C G 0.18 TAATGGAGATACTATGAAAAA [C/G]GAGAAAAATGTCACTTTACT
rs6024725 MC3R 20 31 T C 0.22 CCTAGAGACATATCTCAGTTA [A/G]GTTTTAGCCTCACCAGTATT
rs1468271 NPY 7 12 A G 0.06 GACCCTGTAATTTTCAGAAAC [A/G]CACATAGGAGTGGGTGTCTG
rs11100494 NPY5R 4 10 A C 0.05 CAGAAAGATGTCATCATCCAG [A/C]ATTGCGTCCACACAGTCAAC
rs6837793 NPY5R 4 18 A G 0.10 ATGAATTGTCACTCAGAAGAA [A/G]CTTAATAGGCATTAATACTA
rs1801105 HNMT 2 14 T C 0.08 TTTACGTTCTCGAGGTTCGAT [A/G]TCTTGGCTACAAGCTCTAAA
rs12691940 HNMT 2 66 A G 0.00 AATCAACCAAGTGGAAGAAAG [A/G]ATATCAGAGTCTGAAGACAA
rs675 APOA4 11 32 T A 0.16 GAGAAAGAGAGCCAGGACAAG [A/T]CTCTCTCCCTCCCTGAGCTG
rs5092 APOA4 11 30 A G 0.16 CAGTGCTGACCAGGTGGCCAC [A/G]GTGATGTGGGACTACTTCAG
rs26312 GHRL 3 36 A G 0.15 GCTGTTGCTGCTCTGGCCTCT [A/G]TGAGCCCCGGGAGTCCGCAG
rs814628 LIPF 10 26 A G 0.14 ATCGACTTCATTGTAAAGAAA [A/G]CTGGACAGAAGCAGCTACAC
rs1058046 PYY 17 78 C G 0.38 GGAAAAGAGACGGCCCGGACA [C/G]GCTTCTTTCCAAAACGTTCT
rs231460 PYY 17 43 T C 0.23 TGCTCACCCTAGGATGGAGGG [A/G]GCAGTGGGGGCTGGTTAGGA
rs4688046 GSK3B 3 44 T C 0.24 TAGTAAACTATTTCTTCCCAT [A/G]GGAGAAGATGGATTCTTTTC
rs334555 GSK3B 3 24 C G 0.13 AATTATATCTTATTATTAAAA [C/G]TCTACCAACTCAAAGCTTCC
rs10934502 GSK3B 3 40 T C 0.24 GCTTCCTTATGTAAAATGTAG [A/G]TATTTCTAAAGTAACGCAAT
rs2287754 GYS1 19 25 A G 0.15 CGGGAAGCTTGCAAGACGCTC [A/G]GCTTCCTATTGCAAGACCGC
rs1478290 GYS2 12 59 T G 0.26 AATGTGGCTGAAGCCAAAAGC [A/C]TAATGAATGAGGGGAAGCCT
rs2306179 GYS2 12 52 A G 0.27 TTTCAGTAGGTTTGCAGGGAA [A/G]CCAACTCAAAGCTATATCTG
rs10505873 GYS2 12 67 T C 0.49 TGCTCAGCCTTCTTCAATGAC [A/G]GTGTTTTGCTATTGTCTCTA
rs2838549 PFKL 21 15 A G 0.09 GGACACTGGTTCCACCTCCGC [A/G]TGGCTGTACAGTGCTGCCGA
rs2269935 PFKM 12 53 A C 0.26 CGGCAATTAGACTGGCTAGAG [A/C]CACCTCAGTCAGGCTCTCCC
rs3762272 PKLR 1 13 A G 0.06 AACAAAGATTCTCCTTTCCTC [A/G]TTCACCACTTTCTTGCTGTT
rs2856929 PKM2 15 39 A G 0.24 CAGGCTCAGGGTCTAAATTCC [A/G]TATCCTTTCTTCCATACCCT
rs4890109 RARA 17 10 T G 0.05 GGCTGCTCAGGGCCTCGTCCA [A/C]CCCCAGCCTGACAGAGAGCT
rs9904270 RARA 17 29 T C 0.15 GCCTTCCCCTTAGAGAAGAGC [A/G]CCTGCCAGACAAGGGAGAAG
rs2033447 RARB 3 43 T C 0.20 ATGCCGGGTGCTAGAGATACA [A/G]CAGTGAACATGACAAAGTTC
rs1290443 RARB 3 30 A G 0.15 AGAAGCTCTTTCATGTTGTCA [A/G]TTTTAGAAATCCAAATCATT
rs322695 RARB 3 29 A G 0.15 CCTGTAGGATTGTGTTCCTCT [A/G]AAACTGTCCCCTAAATTATG
rs2838549 PFKL 21 51 A G 0.09 GGACACTGGTTCCACCTCCGC [A/G]TGGCTGTACAGTGCTGCCGA
rs157864 RXRG 1 17 T C 0.10 ATGATATTGAATTAAAGGAAA [A/G]TGAATGGTCTCAGTCAGAGA
rs3118536 RXRA 9 31 A C 0.14 CTGCAGGTGCACGGTTTCCTG [A/C]TTGCCCAGGTGTCTCTGAGC
rs4917348 RXRA 9 40 A G 0.21 GGTGGGGTTAGAGGGGATGGT [A/G]CCTGGCAGTGTGCAGCAGAC
rs3750546 RXRA 9 43 A G 0.20 CCTGAGGATGAAGGGGCGTCC [A/G]TGGCCAGGCAGCAGTGAGAA
rs157864 PYY 1 17 T C 0.10 ATGATATTGAATTAAAGGAAA [A/G]TGAATGGTCTCAGTCAGAGA
rs2058112 ADIPOR2 12 27 T C 0.15 TCTTCTTGCCCTACATACTTC [A/G]AAAGCCCTTGGAGAAATCCT
rs7975375 ADIPOR2 12 31 T C 0.17 CTTTTCACAGGAAAATTTCTT [A/G]GGAGTCTATTGTCACTGTCT
rs12695902 AGTR1 3 16 A G 0.09 CATCAGGATTATCAGCATTTA [A/G]GCCAGAGTTGCAAATTAAGT
rs931490 AGTR1 3 23 A G 0.19 GGCGCCCCCTGGACTTCTGCT [A/G]GAATTTAGATTTAAATAGAT
rs5950584 AGTR2 X 8 T G 0.04 CTATCCTCAAATGCTATATAA [A/C]CCAACTGGTGGAAAAAAATT
rs3219177 RETN 19 31 T C 0.15 CCAGGGATCAGTGAGGTCTCT [A/G]AGACCCTTGGGGAGCTTGCC
rs7412 APOE 19 18 T C 0.08 CGGCCTGGTACACTGCCAGGC [A/G]CTTCTGCAGGTCATCGGCAT
rs429358 APOE 19 31 T C 0.14 GGTACTGCACCAGGCGGCCGC [A/G]CACGTCCTCCATGTCCGCGC
rs405509 APOE 19 79 A C 0.00 GAGGACACCTCGCCCAGTAAT [A/C]CAGACACCCTCCTCCATTCT
rs439401 APOE 19 59 T C 0.34 GAGAACTGAGGGGGTGGGAGG [A/G]GAAGAGAGTGCCGGCGGCTC
rs446037 APOE 19 5 A C 0.02 AGACACAGGTGACCCAACTCC [A/C]ATGGCTGGCCTAGGCCCCTC
rs5883 CETP 16 13 T C 0.06 AGCTACCTTGGCCAGCGAGTG [A/G]AAGACTCGCTCAGAGAACCA
rs1532624 CETP 16 76 T G 0.00 TCTGCCCCTTTGGGCTGCAGC [A/C]TCACAAGCTGTGTGGCGTTG
rs3764261 CETP 16 46 T G 0.27 AGTGAATGAGATAGCAGACAA [A/C]CCAGATGCCTACCGACAGGT
rs5880 CETP 16 15 C G 0.08 GATATCGTGACTACCGTCCAG [C/G]CCTCCTATTCTAAGAAAAGC
  1. Chr: chromosome location of the gene; mac: the number of minor alleles found; maj: sequence of the most common allele, major; min: sequence of the least common allele, minor; Freq: frequency (0.00–1.00) of the minor allele in the study population.