Skip to main content

Table 2 Gene name, gene product size, and forward and reverse primer sequences used in GeXP assays of antioxidant and oxidative stress related genes in rat liver

From: Gamma-oryzanol rich fraction regulates the expression of antioxidant and oxidative stress related genes in stressed rat's liver

Gene Name Fragment Size Left Sequence w/Universals Right Sequence w/Universals
Ubb 187 AGGTGACACTATAGAATAGACACCATCGAGAACGTGAA GTACGACTCACTATAGGGAGACAAGGTGCAGGGTTGACT
18S a 194 AGGTGACACTATAGAATAGCTCCAGGACGGAGTTCATA GTACGACTCACTATAGGGACAGCAGGTGGAGCTCTGATT
Nfkbib 204 AGGTGACACTATAGAATACCCGAGGATGAGGATGATAA GTACGACTCACTATAGGGATCATCAGGAAGAGGTTTGGC
Akr1b1 210 AGGTGACACTATAGAATACGCAGAAGTCTGAAGCTGTG GTACGACTCACTATAGGGACTGGTACTGCCCTCCACATT
Grm5 213 AGGTGACACTATAGAATAGCCAACTTTAATGAGGCCAA GTACGACTCACTATAGGGATGATGTACACCTTCGGGACA
Apo E 230 AGGTGACACTATAGAATAGAAGATGAAGGCTCTGTGGG GTACGACTCACTATAGGGACTCTGCAGCTCTTCCTGGAC
Stip1 236 AGGTGACACTATAGAATAACTACAACAAATGCCGGGAG GTACGACTCACTATAGGGATGGCACTTCTTGAGCACATC
Cox11 244 AGGTGACACTATAGAATACTTCCTTCCCCCATCTGTTT GTACGACTCACTATAGGGACTGTTCCTCACAATGGCTCA
(Mt1a) 250 AGGTGACACTATAGAATACACCAGATCTCGGAATGGAC GTACGACTCACTATAGGGAACTGTTCGTCACTTCAGGCA
Oxsr1 257 AGGTGACACTATAGAATACAGCGATTGAACTAGCCACA GTACGACTCACTATAGGGATTGTGCCTCAACAGTTCTGC
GPX 271 AGGTGACACTATAGAATATCAACATCGAGCCTGACATC GTACGACTCACTATAGGGACAGACTTAGAGCCCCCAGTG
Gapdh a 279 AGGTGACACTATAGAATAATCAATGGATTTGGACGCAT GTACGACTCACTATAGGGAAGCTCCAGGGGATTTCCTTA
SOD1 285 AGGTGACACTATAGAATACTTGCTTTTTGCTCTCCCAG GTACGACTCACTATAGGGAAAAATGAGGTCCTGCAGTGG
Hao1 293 AGGTGACACTATAGAATACCTGTCAGACCATGGGAACT GTACGACTCACTATAGGGATGAGCTGTGGTGGTAGCTTG
NADH 298 AGGTGACACTATAGAATAGTGAAGCCCATTTTCAGTCG GTACGACTCACTATAGGGATAATGTGTGTCCGCTGCTTC
Actb a 307 AGGTGACACTATAGAATAATGTACGTAGCCATCCAGGC GTACGACTCACTATAGGGAAGGGCAACATAGCACAGCTT
Cat 314 AGGTGACACTATAGAATAGTGGTTTTCACCGACGAGAT GTACGACTCACTATAGGGACACGAGGTCCCAGTTACCAT
Knar b 325 AGGTGACACTATAGAATAATCATCAGCATTGCATTCGATTCCTGTTTG GTACGACTCACTATAGGGAATTCCGACTCGTCCAACATC
  1. a Gene used for normalization
  2. b Internal control