Skip to main content

Advertisement

Table 1 Gene-specific primer sequences used in real-time PCR amplification

From: Moderate doses of conjugated linoleic acid reduce fat gain, maintain insulin sensitivity without impairing inflammatory adipose tissue status in mice fed a high-fat diet

Gene Primer sequence (5' → 3') Product length (bp) Primer efficiency
Adiponectin F: GCTCAGGATGCTACTGTTG 255 1.9
  R: TCTCACCCTTAGGACCAAG   
Leptin F: TTGTCACCAGGATCAATGACATTT 106 1.9
  R: GACAAACTCAGAATGGGGTGAAG   
MCP1 F: GCTCTCTCTTCCTCCACCAC 208 1.8
  R: GCTTCTTTGGGACACCTGCT   
Emr1 F: TTTCCTCGCCTGCTTCTTC 222 1.8
  R: CCCCGTCTCTGTATTCAACC   
IL-6 F: TGGGAAATCGTGGAAATGAG 249 1.9
  R: GAAGGACTCTGGCTTTGTCTT   
TNFα F: CGTCGTAGCAAACCACCAA 145 1.7
  R: GAGAACCTGGGAGTAGACAAGG   
iNOS F: GGCAGCTACTGGGTCAAAGA 172 1.8
  R: TCTGAGGGCTGACACAAGG   
18S F: CGCGGTTCTATTTTGTTGGT 219 1.9
  R: AGTCGGCATCGTTTATGGTC   
  1. F, forward; R, reverse. Target genes: adiponectin; leptin; monocyte chemotactic protein-1 (MCP1); epidermal growth factor module-containing mucin-like receptor 1 (Emr1); interleukin-6 (IL-6); tumor necrosis factor alpha (TNFα); inducible nitric oxide synthase (iNOS). 18S rRNA was used for normalization.