Dietary supplementation of soy germ phytoestrogens or estradiol improves spatial memory performance and increases gene expression of BDNF, TrkB receptor and synaptic factors in ovariectomized rats

Table 2 Sequences of PCR primers and conditions of PCR amplification of cDNA.

						Conditions of PCR amplification of cDNA
Primer name	Sequences	Products (bps)	Tm	length	OD's	Denaturation	Annealing	Extension	Cycles
GAPDH forward	gggtgtgaaccacgagaaat	481	47	20	11	94°C for 30 s	55°C for 30 s	68°C for 35 s	33
GAPDH reverse	ggaagaatgggagttgctgt		47	20	10.1
BDNF forward	tgtgacagtattagcgagtgggt	219	59.1	23	5	94°C for 30 s	50°C for 30 s	68°C for 15 s	40
BDNF reverse	cgattgggtagttcggcatt		60	20	5
TrkB forward	cttatgcttgctggtcttgg	503	47	20	10.4	94°C for 30 s	59°C for 60 s	72°C for 35 s	38
TrkB reverse	gggtattcttgctgctctca		47	20	9.4
Synaptophysin forward	catcttcgcctttgctacg	508	46	19	10.8	94°C for 30 s	55°C for 30 s	68°C for 35 s	40
Synaptophysin reverse	cactgaggtgttgagtcctga		49	21	8.8
synaptotagmin 1 forward	gttgcggtccttttagtcgt	496	47	20	9.3	94°C for 30 s	55°C for 30 s	68°C for 35 s	33
synaptotagmin 1 reverse	agtcatacacagccatcacca		47	21	9.6
synapsin 1 forward	agcagcacaacataccctgtag	459	50	22	12.3	94°C for 30 s	52°C for 30 s	68°C for 35 s	40
synapsin 1 reverse	gaccacaagttccacgatga		47	20	7.7
PSD-95 forward	gccctgtttgattacgaca	492	44	19	8.2	94°C for 30 s	55°C for 30 s	68°C for 35 s	40
PSD-95 reverse	gaacttgtgtgcctggatgt		47	20	8.7
spinophilin forward	gaggaaagtggggagtctga	510	48	20	8.2	94°C for 30 s	58°C for 30 s	72°C for 35 s	37
spinophilin reverse	ctcattgcgtcggtcatagt		47	20	7.8

ISSN: 1743-7075