Skip to main content

Table 2 Sequences of PCR primers and conditions of PCR amplification of cDNA.

From: Dietary supplementation of soy germ phytoestrogens or estradiol improves spatial memory performance and increases gene expression of BDNF, TrkB receptor and synaptic factors in ovariectomized rats

       Conditions of PCR amplification of cDNA
Primer name Sequences Products (bps) Tm length OD's Denaturation Annealing Extension Cycles
GAPDH forward gggtgtgaaccacgagaaat 481 47 20 11 94°C for 30 s 55°C for 30 s 68°C for 35 s 33
GAPDH reverse ggaagaatgggagttgctgt   47 20 10.1     
BDNF forward tgtgacagtattagcgagtgggt 219 59.1 23 5 94°C for 30 s 50°C for 30 s 68°C for 15 s 40
BDNF reverse cgattgggtagttcggcatt   60 20 5     
TrkB forward cttatgcttgctggtcttgg 503 47 20 10.4 94°C for 30 s 59°C for 60 s 72°C for 35 s 38
TrkB reverse gggtattcttgctgctctca   47 20 9.4     
Synaptophysin forward catcttcgcctttgctacg 508 46 19 10.8 94°C for 30 s 55°C for 30 s 68°C for 35 s 40
Synaptophysin reverse cactgaggtgttgagtcctga   49 21 8.8     
synaptotagmin 1 forward gttgcggtccttttagtcgt 496 47 20 9.3 94°C for 30 s 55°C for 30 s 68°C for 35 s 33
synaptotagmin 1 reverse agtcatacacagccatcacca   47 21 9.6     
synapsin 1 forward agcagcacaacataccctgtag 459 50 22 12.3 94°C for 30 s 52°C for 30 s 68°C for 35 s 40
synapsin 1 reverse gaccacaagttccacgatga   47 20 7.7     
PSD-95 forward gccctgtttgattacgaca 492 44 19 8.2 94°C for 30 s 55°C for 30 s 68°C for 35 s 40
PSD-95 reverse gaacttgtgtgcctggatgt   47 20 8.7     
spinophilin forward gaggaaagtggggagtctga 510 48 20 8.2 94°C for 30 s 58°C for 30 s 72°C for 35 s 37
spinophilin reverse ctcattgcgtcggtcatagt   47 20 7.8