Skip to main content

Table 1 Primer Sequences for quantitative PCR

From: Anthocyanidins-enriched bilberry extracts inhibit 3T3-L1 adipocyte differentiation via the insulin pathway

Gene Name Accession Number (NCBI Nucleaotide) forward Reverse
Pparγ NM_011146.2 GTGCCAGTTTCGATCCGTAGA GGCCAGCATCGTGTAGATGA
Adiponectin NM_009605.4 GCACTGGCAAGTTCTACTGCAA GTAGGTGAAGAGAACGGCCTTGT
C/ebpα NM_007678.3 GTGTGCACGTCTATGCTAAACCA GCCGTTAGTGAAGAGTCTCAGTTT
C/ebpβ NM_009883.2 GTTTCGGGACTTGATGCAATC AACAACCCCGCAGGAACAT
C/ebpδ NM_007679.4 GATCTGCACGGCCTGTTGTA CTCCACTGCCCACCTGTCA
Srebp1c NM_011480.2 GTTACTCGAGCCTGCCTTCAGG CAAGCTTTGGACCTGGGTGTG
Klf5 NM_009769.3 GGTCCAGACAAGATGTGAAATGG TTTATGCTCTGAAATTATCGGAACTG
β-actin NM_007393.2 AGCCTTCCTTCTTGGGTATGG CACTTGCGGTGCACGATGGAG