Skip to main content

Advertisement

Table 2 Sequences of primers and probes for different adipocyte specific genes used in real-time RT-PCR

From: Dietary constituents reduce lipid accumulation in murine C3H10 T1/2 adipocytes: A novel fluorescent method to quantify fat droplets

Gene name Forward/Reverse Primer Probe
Adiponectin (Acrp30) 5'-GGCACTCCTGGAGAGAAGGG 5'-ATTCCAACATCTCCTGTCTCACC 5'-GAAAGGAGATGCAGGTCTTCTTGGTCCTA
Fatty acid binding protein 4, adipocyte type (aP2) 5'-GCGTGGAATTCGATGAAATCA 5'-CCCGCCATCTAGGGTTATGA 5'-CGCAGACGACAGGAAGGTGAAGAGC
Acetyl-CoA carboxylase (ACC1) 5'-TCACTCGCTTTGGAGGCAA 5'-CGCAGCGATGCCATTGT 5'-AGGGTCATAGAGAAGGTGCTCATCGCC
Lipoprotein lipase (LPL) 5'-GTGGCCGAGAGCGAGAAC 5'-AAGAAGGAGTAGGTTTTATTTGTGGAA 5'-TTCCCTTCACCCTGCCCGAGG
Hormone sensitive lipase (HSL) 5'-AAGACCACATCGCCCACAG 5'-CAGACACACTCCTGCGCATAG 5'-AGAGTCTGTGCGCCCCACGGA
Fatty acid synthase (FAS) 5'-TCATAAAGCAGTTTCTTGATGTGGA 5'-CAGGCTCTTCAGTGGCAGC 5'-CACAGCAAGGTGCTGGAGGCCC
Carnitine palmitoyl transferase β (CPT-1 β) 5'-CCAATCATCTGGGTGCTGG 5'-TAAGAGACCCCGTAGCCATCAT 5'-TGGCTTTGGTCCCGTGGCG
Glucose transporter 4 (Glut4) 5'-TCGGCTCTGACGATGGG 5'-CCAAGCCAGCTGAGAATACAG 5'-AACCCCCTCGGCAGCGAGTGACTG
Peroxisome proliferator activated receptor gamma 2a (PPARγ 2a) 5'-CTATGAGCACTTCACAAGAAATTACCAT 5'-TCCATCACGGAGAGGTCCAC 5'- TCTGGCCCACCAACTTCGGAATCAG
Peroxisome proliferator activated receptor alpha (PPARα) 5'-GCCTCAGGGTACCACTACGG 5'-GCCGAATAGTTCGCCGAA 5'-CACGCATGTGAAGGCTGTAAGGGCTT
CCAAT/enhancer binding protein alpha (C/EBPα) 5'-CGGTGCGGGCAAAGC 5'-TGCGTTCCCGCCGTAC 5'-AGAAGTCGGTGGACAAGAACAGCAAC
18S rRNA 5'-CGGCTACCACATCCAAGG 5'-CGGGTCGGGAGTGGGT 5'-TTGCGCGCCTGCTGCCT