Skip to main content

Table 1 Primers used for real-time PCR

From: UPR in palmitate-treated pancreatic beta-cells is not affected by altering oxidation of the fatty acid

Target Forward primer Reverse primer
b-actin 5'-TCTGTGTGGATTGGTGGCTC-3' 5'-GACTCATCGTACTCCTGCTTGCT-3'
CHOP/GADD153 5'-CCAGCAGAGGTCACAAGCAC-3' 5'-CGCACTGACCACTCTGTTTC-3'
GADD34 5'-GTCCATTTCCTTGCTGTCTG-3' 5'-AAGGCGTGCCCATGCTCTGG-3'
ATF4 5'-GTTGGTCAGTGCCTCAGACA-3' 5'-CATTCGAAACAGAGCATCGA-3'
Spliced XBP1 rat 5'-GAGTCCGCAGCAGGTG-3' 5'-GCGTCAGAATCCATGGGA -3'
EDEM 5' -CAGTCAAGTTAGTGATCAACAC- 3' 5' - TGTCATGTCACCAAAGGGCTG - 3'