Skip to main content

Table 1 Characteristics of porcine primer pairs used for validation of microarray analysis using RT-PCR

From: Effect of L-carnitine on the hepatic transcript profile in piglets as animal model

Gene symbol Primer sequence (5'-3') GenBank
accession no.
Product size (bp)
ACADSB For:TCGTGATACCGAGGGCCTCCG XM_001926297.2 196
  Rev:TCCCAGCATCTGTGCCGCAA   
ACSL3 For:TCGCTGCACAGGCCTGCTTC NM_001143698.1 174
  Rev:GCAGGCGCGGCACTAGAGAG   
DRE1 For:CAACAACCTCCGATACTACC NP_060114.2 158
  Rev:GGTCCTCCACCAATCACAAA   
ESRRG For:GGATCAGATGAGTCTTCTGC XM_003357621.1 127
  Rev:GGACTGGTCTTCATCCATTAT   
FbxL3 For:CATAGGAGACACACCGTCTA Q9UKT7 637
  Rev:GTGGGCATCATGTCTGGAAA   
FbxL20 For:GTGAGGGATGTCCACTGTTG XM_003131523.2 128
  Rev:CTGTGTGCAGCCTTTTAAGAA   
FbxO32 For:TCACAGCTCACATCCCTGAG NM_001044588 167
  Rev:GACTTGCCGACTCTCTGGAC   
GCK For:GAGCGAGAGAGCAGAGCCTCAGA XM_003356680.1 221
  Rev:CTGGAGCCAGCCTCCGAACG   
GLUT8 For:GTGGAGCCCACCGATGCCAG EU012361.2 145
  Rev:CCACGCCCTTGACGTGCAGA   
GPAT For:GAATTGATCTCTCCACGTTG XM_001927875.1 257
  Rev:CCTCCATGATAAAGTCGTGG   
GPD1 For:GGCCGGCTGGCACACTTTGA NM_001190240.1 354
  Rev:CATGGGGATGCCAAGGCGCT   
HECTD2 For:GGTTTGGACAGAGGATCCAAA XM_003361201.1 130
  Rev:CATTCTTGATGTTAGGGAAAAC   
MTTP For:TCCCGCTGCACCAAGAGAACT NM_214185.1 151
  Rev:TACCTCGGCACGGTGCATCGT   
USP10 For:GTGGTGTACCAGCAGAGCT XM_003126825.2 157
  Rev:GCTTGGTTTTGGTGGTGTAG