Skip to main content

Advertisement

Table 1 Primer sequences

From: Guava leaf extracts alleviate fatty liver via expression of adiponectin receptors in SHRSP.Z-Leprfa/Izm rats

Gene Forward Reverse
AdipoR1 TGAGGTACCAGCCAGATGTC CGTGTCCGCTTCTCTGTTAC
AdipoR2 TCCATGGAGTCTCAAACCTG GGAGAGTATCACAGCGCATC
PPAR-alpha TGGAGTCCACGCATGTGAAG TGTTCCGGTTCTTTTTCTGAATCT
MCAD TGTGCCTACTGCGTGACAGA TTCATCACCCTTCTTCTCTGCTT
ACO CCCAAGACCCAAGAGTTCATTC CACGGATAGGGACAACAAAGG
β-actin GGGAAATCGTGCGTGACATT GCGGCAGTGGCCATCTC