Skip to main content

Table 1 Overlapping primers used for generating the specified mutation sites in hRFVT-2

From: Identification of residues/sequences in the human riboflavin transporter-2 that is important for function and cell biology

Construct Forward and reverse primers (5’-3’)
GFP-hRFVT-2[F119A] TTAGCACTGGCCGCTGTGCTGGCACTG; CAGTGCCAGCACAGCGGCCAGTGCTAA
GFP-hRFVT-2[V120A] GCACTGGCCTTTGCGCTGGCACTGGCA; TGCCAGTGCCAGCGCAAAGGCCAGTGC
GFP-hRFVT-2[L121A] CTGGCCTTTGTGGCGGCACTGGCATGC; GCATGCCAGTGCCGCCACAAAGGCCAG
GFP-hRFVT-2[L123P] TTTGTGCTGGCACCGGCATGCTGTGCC; GGCACAGCATGCCGGTGCCAGCACAAA
GFP-hRFVT-2[L339P] TCCTTGGCAGGGCCGGGCGGCCTCTCT; AGAGAGGCCGCCCGGCCCTGCCAAGGA
GFP-hRFVT-2[L342A] GGGCTGGGCGGCGCCTCTCTGCTGGGC; GCCCAGCAGAGAGGCGCCGCCCAGCCC
Real-Time PCR primers  
hRFVT-2 CCCTGGTCCAGACCCTA; ACACCCATGGCCAGGA
β-Actin AGCCAGACCGTCTCCTTGTA; TAGAGAGGGCCCACCACAC
  1. The mutated DNA sequences are in bold face text.