Skip to main content

Table 2 Primer pairs used for generating the full-length, N- and C-terminal tail truncated constructs of hRFVT-2 by PCR

From: Identification of residues/sequences in the human riboflavin transporter-2 that is important for function and cell biology

Construct Forward and reverse primers (5’-3’) Positions (bp) Fragment size (bp)
GFP-hRFVT-2[1–445] CCCAAGCTTATGGCAGCACCCACGCCCGCC; TCCCCGCGGGGAGTCACAGGGGTCTGCACA 1-1335 1335
GFP-hRFVT-2[1–424] CCCAAGCTTATGGCAGCACCCACGCCCGCC; TCCCCGCGGGAACATAGCAACAGCGCC 1-1272 1272
GFP-hRFVT-2[10–445] CCCAAGCTTATGGTGCTGACCCACCTGCTG; TCCCCGCGGGGAGTCACAGGGGTCTGCACA 28- 1335 1307
GFP-hRFVT-2[10–424] CCCAAGCTTATGGTGCTGACCCACCTGCTG; TCCCCGCGGGAACATAGCAACAGCGCC 28-1272 1244
  1. Combination of primers and primer sequence used to generate each construct are shown. The restriction enzyme sites Hind III (boldface italic text) and Sac II (boldface text) were added to the hRFVT-2 primer to enable subsequent sub-cloning into green fluorescent protein (GFP-C3) vector.