Skip to main content

Table 1 Mouse primers used for real-time PCR analysis

From: Quercetin reduces obesity-induced hepatosteatosis by enhancing mitochondrial oxidative metabolism via heme oxygenase-1

Gene Forward primer (5′ → 3′) Reverse primer (5′ → 3′)
Nrf-2 TCCGCTGCCATCAGTCAGTC ATTGTGCCTTCAGCGTGCTTC
HO-1 TGCAGGTGATGCTGACAGAGG GGGATGAGCTAGTGCTGATCTGG
PGC-1α CCGTAAATCTGCGGGATGATG CAGTTTCGTTCGACCTGCGTAA
Nrf-1 GACCTTGCCACAGGCAGGTAA CGCCTGCTCCATGAACACTC
Tfam TCAGGAGCAGCAGGCACTACA CTGAGCTCCGAGTCCTTGAACAC
PPARα ACGCTCCCGACCCATCTTTAG TCCATAAATCGGCACCAGGAA
CPT-1α TGGCTTCAGAGCCAGTGGAG AGCGATGGTGGCTGTCATTC
β-actin CATCCGTAAAGACCTCTATGCCAAC ATGGAGCCACCGATCCACA
GAPDH GGCTATCACGGAGGCTGTGAA CCAGCCTTAGCATCAAAGATGGA