Skip to main content

Advertisement

Table 1 Primer sequences for amplification of 16S rRNA genes, amplicon length 507 bp

From: Heat-treated high-fat diet modifies gut microbiota and metabolic markers in apoe−/− mice

16S Amplicon PCR Forward Primer 27F AGAGTTTGATCCTGGCTCAG
16S Amplicon PCR Reverse Primer 534R ATTACCGCGGCTGCTGG