Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer sequences for amplification of 16S rRNA genes, amplicon length 507 bp

From: Heat-treated high-fat diet modifies gut microbiota and metabolic markers in apoe−/− mice

16S Amplicon PCR Forward Primer 27F AGAGTTTGATCCTGGCTCAG
16S Amplicon PCR Reverse Primer 534R ATTACCGCGGCTGCTGG