Skip to main content

Advertisement

Table 1 Primer sequences and real-time PCR conditions used for gene expression analysis by qRT-PCR

From: The role of I-FABP as a biomarker of intestinal barrier dysfunction driven by gut microbiota changes in obesity

Gene name Primer Sequence (5’-3’) AT
I-FABP ATGGAAAGGAGCTGATTGCT 59 °C
TTGGCCTCCACTCCTTCATA
TLR4 GATGCCTCTCTTGCATCTGG 60 °C
TCATGAGGGATTTTGCTGAGA
GAPDH GGCATCGTGGAAGGGCTCATGAC 62 °C
ATGCCAGTGAGCTTCCCGTTCAGC
  1. AT annealing temperature, GAPDH glyceraldehyde-3-phosphate dehydrogenase (housekeeping gene), I-FABP intestinal fatty acid binding protein, TLR4 Toll-like receptor 4