Skip to main content

Advertisement

Table 1 PCR primers

From: Over-expression of Slc30a8/ZnT8 selectively in the mouse α cell impairs glucagon release and responses to hypoglycemia

Gene Sequence
β Actin FOR: CGAGTCGCGTCCACCC
REV: CATCCATGGCGAACTGGTG
Glucagon FOR: CCAAGAGGAACCGGAACAAC
REV: CCTTCAGCATGCCTCTCAAAT
Human ZnT8 FOR: CTGTCATCGAAGCCTCCCTC
REV: AAGGGCATGCACAAAAGCAG
Glu-rtTA FOR: CATAAACGGCGCTCTGGAATTACTCAATGGAGTCG
REV: GCCGAGATGCACTTTAGCCCCGTCGCGATGTGAGA
Luciferase FOR: CAACTGCATAAGGCTATGAAGAGA
REV: ATTTGTATTCAGCCCATATCGTTT