Skip to main content

Table 1 Primer sequences

From: 2-amino-1-methyl-6-phenylimidazo(4,5-b) pyridine (PhIP) induces gene expression changes in JAK/STAT and MAPK pathways related to inflammation, diabetes and cancer

Symbol Forward Primer Reverse Primer Accession number
CYP1A1 GATCCCAGGCTCCAAGAGTC ATCTTGGAGGTGGCTGAGGTA NM_000499
CYP1A2 CACCTGCCTCTACAGTTGGTA GAAGCTCTGTGGCCGAGAAG NM_000761
SULT1A1 AGGAGTTCATGGACCACAGC TGAAGGTGGTCTTCCAGTCC NM_177536.2
UGT1A1 AATAAAAAAGGCTCTGCT ACATCAAACTGCTTTCTGC NM_000463
HPRT1 CTCCTGAGCAGTCAGCCCGC CACTAATCACGACGCCAGGGCT NM_000194
  1. Primer Sequences of PhIP metabolizing enzymes