Skip to main content

Table 1 qPCR primers used to assess gene expression of markers of lipid/fatty acid metabolism

From: The effects of prenatal metformin on obesogenic diet-induced alterations in maternal and fetal fatty acid metabolism

Gene Primer Sequence 5′ _ 3′ Accession numbera
(Probe number)
Chrebp Forward
Reverse
AATCCCAGCCCCTACACC
CTGGGAGGAGCCAATGTG
NM_133552.1 (10)
D5d Forward
Reverse
GAACTCTCTTCTGATTGGAGAGCTA
CCGGAATTCATCAGTGAGC
AB052085.1 (26)
D6d Forward
Reverse
AATTTCCAGATTGAGCACCAC
AGTGGGGCAATCTTGTGC
NM_031344.2 (60)
D9d Forward
Reverse
GAAGCGAGCAACCGACAG
GGTGGTCGTGTAGGAACTGG
NM_139192.2 (125)
Elovl2 Forward
Reverse
AACCTCGGAATCACACTTCTTT
TCCCAGCTGGAGAGAACG
NM_001109118.1 (22)
Elovl5 Forward
Reverse
TCGATGCGTCACTCAGTACC
CCTTTGACTCGTGTGTCTCG
NM_134382.1 (122)
Elovl6 Forward
Reverse
ATGGATGCAGGAAAACTGGA
GCCCGCTTGTTCATCAGA
NM_134383.2 (119)
Fasn Forward
Reverse
GGCCACCTCAGTCCTGTTAT
AGGGTCCAGCTAGAGGGTACA
NM_017332.1 (6)
Lxrα Forward
Reverse
CAGGAAGAGATGTCCTTGTGG
TCTTCCACAACTCCGTTGC
NM_031627.2 (2)
Lxrβ Forward
Reverse
AGCTCTGCCTACATCGTGGT
GACCCTTCTTCCGCTTGC
NM_031626.1 (106)
Srebf Forward
Reverse
ACAAGATTGTGGAGCTCAAGG
TGCGCAAGACAGCAGATTTA
NM_001276707.1 (77)
  1. Forward and reverse primers for rat genes with GenBank Accession numbers and specific Roche Universal Probe numbers used for assessing mRNA expression in rat tissues by qPCR
  2. aNational Center for Biotechnology Information (NCBI) EntrezGene (http://www.ncbi.nlm.nih.gov/gene)