Skip to main content

Table 1 Primer sequences for real-time PCR

From: Hepatic adaptations to maintain metabolic homeostasis in response to fasting and refeeding in mice

Target Forward primer (5′-3′) Reverse primer (5′-3′) Gene ID
Peroxisome Proliferator Activated Receptor α AGAGCCCCATCTGTCCTCTC ACTGGTAGTCTTGCAAAACCAAA 19013
  1. Annealing temperature for all primer pairs was 58 °C, except HMGCS2 which was 55 °C