Skip to main content

Advertisement

Table 1 Primer sequences for real-time PCR

From: Hepatic adaptations to maintain metabolic homeostasis in response to fasting and refeeding in mice

Target Forward primer (5′-3′) Reverse primer (5′-3′) Gene ID
β-actin TCGGTGACATCAAAGAGAAG GATGCCACAGGATTCCATA 11461
β-OH Butyrate Dehydrogenase 1 AGGCTGTGACTCTGGATTTGGG CTGGATGGTTCTCAGTCGGTCA 71911
β-OH Butyrate Dehydrogenase 2 AGGAGCTGGAAAGACCGAGG TCGCAATCCAGGATGGTTCCGT 69772
3-hydroxy-3-methylglutaryl-CoA Synthase II AGAGAGCGATGCAGGAAACTT AAGGATGCCCACATCTTTTGG 15360
Peroxisome Proliferator Activated Receptor α AGAGCCCCATCTGTCCTCTC ACTGGTAGTCTTGCAAAACCAAA 19013
Uncoupling Protein 2 ATGGTTGGTTTCAAGGCCACA CGGTATCCAGAGGGAAAGTGAT 22228
Glucose 6 Phosphatase CGACTCGCTATCTCCAAGTGA GTTGAACCAGTCTCCGACCA 14377
Phosphoenolpyruvate Carboxykinase CTGCATAACGGTCTGGACTTC CAGCAACTGCCCGTACTCC 18534
Carnitine Palmitoyltransferase I CTCCGCCTGAGCCATGAAG CACCAGTGATGATGCCATTCT 12894
  1. Annealing temperature for all primer pairs was 58 °C, except HMGCS2 which was 55 °C