Skip to main content

Table 1 Real-Time RT-PCR Primer Sequences

From: Plasticity of adipose tissue in response to fasting and refeeding in male mice

Gene Forward primer (5’ to 3’) Reverse primer (5’ to 3’)
β-actin TCG TTAC CAC AGG CAT TGT GAT TGC TCG AAG TCT AGA GCA AC
Ucp-1 AAGCGTACCAAGCTGTGCGA AGAAAAGAAGCCACAAACCCTT
Pgc-1α TGAACGCACCTTAAGTGTGGAA GGGTTATCTTGGTTGGCTTTATGA
Atgl AACACCAGCATCCAGTTCAA GGTTCAGTAGGCCATTCCTC
Hsl TGAGATGGTAACTGTGAGCC ACTGAGATTGAGGTGCTGTC
Pparα ATCCACGAAGCCTACC CACACCGTACTTTAGCAAG
Cpt-1 m TGCCTTTACATCGTCTCCAA GGCTCCAGGGTTCAGAAAGT
Wt1 AGCTGTCCCACTTACAGATGC CCTTGAAGTCACACTGGTATGG
Tcf21 CATTCACCCAGTCAACCTGA TTCCTTCAGGTCATTCTCTGG
Ki67 GAATGAATGCAGAAATCAGCGGTA GATCATGGATGACGCTGTGAGAA
Pcna CGTGAACCTCACCAGCAT ATTTGGAGCTTCAAACACT
Pparγ ATGGTTGACACAGAGATGC GAATGCGAGTGGTCTTCC
C/ebpα CAAGAACAGCAACGAGTACCG GTCACTGGTCAACTCCAGCAC
Srebp-1c GGAGCCATGGATTGCACATT AGGAAGGTTCCAGAGAGGA
Fas CAC ACA CAA TGG ACC CCC AG CAG AGG TGT TCG GCT TCA GG