Skip to main content

Table 2 Primer details (SESN2, B2M and GAPDH)

From: Essential amino acid ingestion alters expression of genes associated with amino acid sensing, transport, and mTORC1 regulation in human skeletal muscle

Gene Sequence (5′- > 3′) Length Start Stop Tm GC% Length Accession #
SESTRIN2 FWD GCCACTCAGAGAAGGTCCAC 20 1739 1758 60.04 60   NM_001199933.1
REV: GAGTCAGGTCATGTAGCGGG 20 1842 1823 59.9 60 104 Exon 1752/1753 fwd
B2M FWD: CCAAAGATTCAGGTTTACTCAC 22    52.5 40.9   NM_00404
REV: TCAACTTCAATGTCGGATGG 20    52.8 45 101  
GAPDH FWD: AGGTGAAGGTCGGAGTCAAC 20    56.3 55   J02642
REV: GCTCCTGGAAGATGGTGATG 20    55 55 231