Skip to main content

Table 1 Primer sequences of genes used in RT-PCR

From: Antiobesity potential of Piperonal: promising modulation of body composition, lipid profiles and obesogenic marker expression in HFD-induced obese rats

Gene Gene Bank No Sense Antisense
PPAR-γ NM_013124 CTGACCCAATGGTTGCTGATTAC GGACGCAGGCTCTACTTTGATC
TNF-α NM_012675 GTCGTAGCAAACCACCAAG AGAGAACCTGGGAGTAGATAAG
FAS NM_017332 GAGGACTTGGGTGCCGATTAC GCTGTGGATGATGTTGATGATAGAC
Fab-4 NM_053365 TCACCCCAGATGACAGGAAA CATGACACATTCCACCACCA
SREBP-1c NM_012767 CGCTACCGTTCCTCTATCA TCGCAGGGTCAGGTTCT
UCP-2 NM_019354 TAAAGCAGTTCTACACCAAGGG CGAAGGCAGAAGTGAAGTGG
HMG-CoA R NM_013134 GGGACCAACCTTCTACCTCAG GACAACTCACCAGCCATCAC
ACC NM_022193 CCTTCTTCTACTGGCGACTGAG TAAGCCTTCACTGTGCCTTCC
β- actin NM_031144 GGCACCACACTTTCTACAAT AGGTCTCAAACATGATCTGG