Skip to main content

Table 1 Characteristics of gene-specific primer pairs used for qPCR

From: The carnitine status does not affect the contractile and metabolic phenotype of skeletal muscle in pigs

Gene Forward primer (from 5` to 3`)
Reverse primer (from 5` to 3`)
Product
size (bp)
NCBI
GenBank
Reference genes
 ATP5G1 CAGTCACCTTGAGCCGGGCGA
TAGCGCCCCGGTGGTTTGC
94 NM_001025218
 ACTB GACATCCGCAAGGACCTCTA
ACATCTGCTGGAAGGTGGAC
205 XM_003124280
 RPS9 GTCGCAAGACTTATGTGACC
AGCTTAAAGACCTGGGTCTG
325 XM_003356050
 SHAS2 GAAAAGGCTAACCTACCCTG
TGTTGGACAAGACCAGTTGG
218 NM_214053
Target genes
 ACADM CATGGCAGCGATGTTTAGGC
GGCACTTGCCCCAGAGTATT
396 NM_214039
 CACT ACTGTGACTCAGACGGACCA
ATATAGCCCCCTGACACCCT
235 XM_003483178
 COX4 GTGGAACTGTACCGCCTGAA
TTGTCGTAGTCCCACTTGGC
257 XM_003355730
 COX6 CTCAGCTCGCATGTGGAAGA
GATGCGAAGATGGGGGTAGG
139 NM_001190221
 FATP1 AAGGGCATGGATGATCGACT
ATCACGTCTGTTGCCTGCAT
143 NM_001083931
 GLUT4 TCACGTCTCTCGCTGCAGGCT
AAAGCCTGTGGGGACAACACCC
205 NM_001128433
 OCTN2 TGCATTTGGCTACATGCTGC
ATGATCACCTCAGCTTCCTG
174 XM_003123912
 PKM CAGCAAGAAAGGTGTGAACC
CTCCCTCGTGATTCTCGATT
218 XM_003356683
 SDHA CTACGCCCCCGTCGCAAAGG
AGTTTGCCCCCAGGCGGTTG
380 DQ402993