Skip to main content

Advertisement

Table 2 Primers sequences used for the determination of gene expression in adipose tissue by qRT-PCR

From: Exposure to maternal cafeteria diets during the suckling period has greater effects on fat deposition and Sterol Regulatory Element Binding Protein-1c (SREBP-1c) gene expression in rodent offspring compared to exposure before birth

Gene Forward Primer (5′-3′) Reverse Primer (5′-3′) Accession No.
PPAR-γ TCCTCCTGTTGACCCAGAGCAT AGCTGATTCCGAAGTTGGTGG NM_013124
SREBP-1c TGCGGACGCAGTCTGGGCAAC GTCACTGTCTTGGTTGTTGATG AF_286469
FAS TGCTCCCAGCTGCAGGC GCCCGGTAGCTCTGGGTGTA NM_017332
G3PDH GCTTCGGTGACAACACCA AGCTGCTCAATGGACTTTCC NM_022215
Adiponectin AATCCTGCCCAGTCATGAAG CATCTCCTGGGTCACCCTTA NM_144744
Leptin ATTTCACACACGCAGTCGGTATCCG CCAGCAGATGGAGGAGGTC NM_013076
CYPα TATCTGCACTGCCAAGACTGAGTG CTTCTTGCTGGTCTTGCCATTCC NM_017101