Skip to main content

Table 3 Primer sequences used for mRNA quantification with qRT-PCR

From: Medium-chain fatty acids decrease serum cholesterol via reduction of intestinal bile acid reabsorption in C57BL/6J mice

Target Genes Human / Mouse Forward (5′-3′) Reverse (5′-3′) Accession no.
ASBTa M AGGCTTTATCCTGTCTGTGGC CAGTGTGGAGCAAGTGGTCAT NM_011388.2
I-BABPb H GAGAGCTGTGTTGTCTGCGT TTGAAGTTGCGGGCCTTTTC NM_001040442.1
M GATCATCACAGAGGTCCAGC CTCCATCTTCACGGTAGCCT NM_008375.2
OST-αc M TCCCTGACGGCATCTATGAC ACAAGCACCTGGAACAGAGC NM_145932.3
OST-βd M GGAACTGCTGGAAGAAATGC TTCTGTTTGCCAGGATGCTC NM_178933.2
  1. agene name: a solute carrier family 10, member 2 (Slc10a2), protein name: apical sodium-dependent bile salt transporter (ASBT)
  2. bgene name: fatty acid binding protein 6 (FABP6/fabp6), protein name: ileal bile acid binding protein (I-BABP)
  3. cgene name: solute carrier family 51, alpha subunit (Slc51a), protein name: organic solute transporter (Ost-α)
  4. dgene name: solute carrier family 51, beta subunit (Slc51b), protein name: organic solute transporter (Ost-β)