Skip to main content

Advertisement

Table 1 Primer sequences used for mRNA quantification by real-time PCR

From: Neonatal overfeeding induced glucocorticoid overexposure accelerates hepatic lipogenesis in male rats

  Forward primer 5′–3′ Forward primer 5′–3′
ACC rat TGAAGGGCTACCTCTAATG TCACAACCCAAGAACCAC
SCD1 rat CTCCCTACCTCCACCCCTAT AACCAACCCTCTCGTTCAGT
FASN rat AAGAGTGGGAGAGCCTGTTC AGTTCACCAAGCCTACCACA
LPL rat GCTTCCCCTTACTGGTTCC AACTGGCAGGCAATGAGACT
L-FABP rat AAGGGAAGGACATCAAGGGG CACTGCCTTGACCTTTTCCC
CPT1 rat ACGAAGAACATTGTGAGCGG GAGGACCTTGACCATAGCCA
MTP rat AGCAACATGCCTACTTCTTACAC TCACGGGTTCACTTTCACTG
SREBP-1c rat CGCTACCGTTCCTCTATCA CTCCTCCACTGCCACAAG
PPARα rat AGCCATTCTGCGACATCA CGTCTGACTCGGTCTTCTTG
GAPDH rat GGCTCTCTGCTCCTCCCTGTTCTA CGTCCGATACGGCCAAATCCGT
ACC hum CACGCTCAAGTCACCAAGAA GCAAATGGGAGGCAATAAGA
SCD1 hum GTTCGTTGCCACTTTCTTGC TGGTAGTTGTGGAAGCCCTC
FASN hum CGGTGTTTGAGTTCGTGGAG CGGGGATAGAGGTGCTGAG
LPL hum TTCTCGTTGGCAGGGTTGAT CTGACACTGTTTTCACGCCA
L-FABP hum TTCAAGTTCACCATCACCGC TTATGTCGCCGTTGAGTTCG
CPT1 hum CAACTCACATTCAGGCAGCA CGATGTGCTTGCTGTCTCTC
MTP hum CTGCTCAGACCTCAGACTCA TCTCTGATGTCACTGCTACCA
SREBP-1c hum TTCCCAGCCCCTCAGATAC GAGAAGCACCAAGGAGACGA
PPARα hum CCAGCATCCTCTCTCCAACT AGGAAAACGAAGACCCAAGAT
GAPDH hum GTCGGAGTCAACGGATTTGG CATGGGTGGAATCATATTGGA