Skip to main content

Advertisement

Table 2 Primers used for RT-PCR

From: GLUT1 and lactose synthetase are critical genes for lactose synthesis in lactating sows

Gene name Gene accession Primer sequence (5′-3′) Size (bp)
GLUT1 EU012358 F: GATGAAGGAGGAGTGCCG 106
R: CAGCACCACGGCGATGAGGAT
SGLT1 NM001164021 CATCATCGTCCTGGTCGTC 138
GGGGCTTCTTGAATGTCCT
HK1 XM003359224 CGAGATAACAAGAGCACACCC 138
GAGGAAACGCACATCACAGTC
HK2 DQ432056 GTTCCTGGCTCTGGATCTTGG 115
GGGATGGCGTAGATCTGGTTC
LALBA NM214360 GTGGTGGGGATTCTCTTTCC 179
TCTGTGCTGCCATTGTCATG
B4GALT1 XM003130680 GAGTTTAACATGGCCGTGGAC 185
TGACGCTGTAGGATTGGGTG
PGM1 NM001246318 TGGTCGCTTGGTTATTGG 123
TTGGGTCCTCCTGGGTTGT
PGM2 XM003128910 CAACAGTGACGCACCCGA 198
GCCACCAGCCCAAGAGG
UGP2 NM213980 TACCACGGCACCATCACA 238
GGTTCCCAAACCACCATT
GALT XM005668043 TGGTTGGCTACGAAATGC 126
TGGCTGCTGTCTCCTTGT
GALE XM003356202 GACTATGACACGGAGGATGG 108
CGTGCCCAGGTTGTAGAT
SLC35A2 XM013986120 GCTGTGGTCATGGCTGAAGT 196
TGGAGATGGCAACATACTGGA
AKT1 NM001159776 CCTGAAGAAGGAGGTCATCG 123
TCGTGGGTCTGGAAGGAGTA
PRLR NM001001868 TTTCTGCTGTCGTCTGTTTGA 142
TCTTCGGACTTGCCTTTCTC
STAT5a NM214290 CATCACCATTGCCTGGAAG 141
CGGTCGGGAAACACATAGAT
STAT5b NM214168 TGTGAGAAGTTGGCGGAGAT 169
CGATGATGAATGTGCTGGTC
ACACA NM001114269 ACATCCCCACGCTAAACA 186
AGCCCATCACTTCATCAAAG
FASN NM001099930 GCTTGTCCTGGGAAGAGTGTA 115
AGGAACTCGGACATAGCGG
PGLS XM003123494 GCTGGACTCTGGGCTTCTG 138
GCAGCTCAGGGTTAATGGTG
β-ACTIN XM003124280 GGATGCAGAAGGAGATCACG 105
ATCTGCTGGAAGGTGGACAG
GAPDH NM001206359 AAGGTCGGAGTGAACGGATT 248
CATTTGATGTTGGCGGGAT
MRPL39 AY610067 CAAAAGAGAACCTACATTCCTTCACA 100
TCTAATGCCACTTTTGCTTCAACT
SDHA DQ402993 ACTCGCTCCTGGACCTCGT 152
GGTTCCGTTCGCAAATCTC
TBP DQ178129 GATGGACGTTCGGTTTAGG 124
AGCAGCACAGTACGAGCAA