Skip to main content

Table 2 Primer sequences for the quantitative real-time qPCR

From: Lipid deposition pattern and adaptive strategy in response to dietary fat in Chinese perch (Siniperca chuatsi)

Gene name Sequence 5′-3′ Tm (°C) Product size (bp) E-values (%)
rpl13a CACCCTATGACAAGAGGAAGC 59 100 102.9
TGTGCCAGACGCCCAAG
pepck CTGAGTTTGTGAAGAGAGCGG 57 170 100.3
GTCCTTTGGGTCTGTGCGT
srebp1 CTCCCTCCTTTCTGTCGGCTC 58 111 103.2
TCATTTGCTGGCAGTCGTGG
fas ATGGAAATCACCCCTGTAATCTT 57 203 101.9
CTTATCTGACTACGGAATGAATCG
accα TATGCCCACTTACCCAAATGC 58 129 102
TGCCACCATACCAATCTCGTT
cpt1 ATGGTGTATTGGCTGGAGTCT 57.5 139 102.8
CTGTGTGGTAGGTTTTCCTTGAT
cs GAATGCCACCTACTTCCTTGT 57 166 98
CCCCTCATACCTCCATAAACC
pc GTCCCGTTCCAGATGC 54 257 101
CTGCCAGTTTCAGATAGTAGTCC
g6pase TGTGGATGGCTTTTTGGGT 58 342 101.5
CAGAGTGAGTGGGCATTTTGAT
apoe TGAGCGACATTTCCACCATA 57 267 95.8
CACCAACCAACTACAACCCAT
lpl TTACCCCAATGGAGGCACTT 58 277 98.8
CGGACCTTGTTGATGTTGTAG
hl CAACCCTGAAGACAAATCTAATA 57.5 180 96.3
CAATCAAATGAGCCTTTCTAACT