Skip to main content

Advertisement

Table 1 Gene-specific primers for RT-PCR

From: Evidence for liver energy metabolism programming in offspring subjected to intrauterine undernutrition during midgestation

Genes Primer sequences (5′-3′) Amplicon size (bp) Accession no.
ACACA F: ATGTGGATGATGGGCTGAA R: GCTTGAACCTGTCGGAAGAG 139 XM_018064168.1
ACOX1 F: ACCTGTGAGTTTGTGCCTGA R: TTGGGCTGGAAAGATGCTAC 109 XM_018063769.1
CPT1α F: TCATACTCGCTGGGAACAGA R: TCTCGGAAGGAAACAAATGC 111 XM_018043311.1
DBP F: GATACGGTGGAGGTGCTGAT R: TCCGAGGGTCAAAGGTCTC 91 XM_018062728.1
G6PC F: CCTGCTTCCTGTTCAGTTTCG R: GCAAAGGGCGTCGTGTCAAT 139 XM_005693878.3
G6PD F: ACCTATGGCAACCGATACAAGA R:GTGGAGCAGTGGAGTGAAGAT 144 XM_018044343.1
INSR F: TCAAGGACGGAGTCTTCACC R: TTTCAGCACCTGCTCATTTG 119 XM_018051134.1
NR1H3 F: TGCTGATGAAACTGGTGAGC R: TGAAGACACGGAGGAGGAAC 147 NM_001285751.1
NR3C1 F: AGAGGGAGAGGGAAATGGAG R: TTGGAATGAGAAGGGTGGTC 121 XM_018050198.1
PCK1 F: GCGTTCAACGTCCGATTTCC R: CTCGATGCCGATCTTGGACA 105 XM_005688314.3
PCK2 F: TACGTGCTTCCGTTCAGCAT R: TTGGCCCACAGAGTGAAGAC 177 XM_018054616.1
PRKAA2 F: TTGATGATGAGGTGGTGGAG R: CCGTGAGAGAGCCAGAGAGT 138 XM_018044652.1
PRKAB1 F: CCACCACATCTCCTCCAAGT R: GAGCACCATCACTCCATCCT 135 XM_013970630.2
PGC1α F: CCGAGAATTCATGGAGCAAT R: GATTGTGTGTGGGCCTTCTT 184 XM_018049155.1
STK11 F: GGACACCTTCTCTGGCTTCA R: CCCTTCCCGATGTTCTCAA 126 XM_018050463.1
ACTG1 F: ATGGCTACTGCTGCGTCGT R: TTGAAGGTGGTCTCGTGGAT 161 XM_018063603.1