Skip to main content

Table 1 Gene-specific primers for RT-PCR

From: Evidence for liver energy metabolism programming in offspring subjected to intrauterine undernutrition during midgestation

Genes Primer sequences (5′-3′) Amplicon size (bp) Accession no.
ACACA F: ATGTGGATGATGGGCTGAA
R: GCTTGAACCTGTCGGAAGAG
139 XM_018064168.1
ACOX1 F: ACCTGTGAGTTTGTGCCTGA
R: TTGGGCTGGAAAGATGCTAC
109 XM_018063769.1
CPT1α F: TCATACTCGCTGGGAACAGA
R: TCTCGGAAGGAAACAAATGC
111 XM_018043311.1
DBP F: GATACGGTGGAGGTGCTGAT
R: TCCGAGGGTCAAAGGTCTC
91 XM_018062728.1
G6PC F: CCTGCTTCCTGTTCAGTTTCG
R: GCAAAGGGCGTCGTGTCAAT
139 XM_005693878.3
G6PD F: ACCTATGGCAACCGATACAAGA
R:GTGGAGCAGTGGAGTGAAGAT
144 XM_018044343.1
INSR F: TCAAGGACGGAGTCTTCACC
R: TTTCAGCACCTGCTCATTTG
119 XM_018051134.1
NR1H3 F: TGCTGATGAAACTGGTGAGC
R: TGAAGACACGGAGGAGGAAC
147 NM_001285751.1
NR3C1 F: AGAGGGAGAGGGAAATGGAG
R: TTGGAATGAGAAGGGTGGTC
121 XM_018050198.1
PCK1 F: GCGTTCAACGTCCGATTTCC
R: CTCGATGCCGATCTTGGACA
105 XM_005688314.3
PCK2 F: TACGTGCTTCCGTTCAGCAT
R: TTGGCCCACAGAGTGAAGAC
177 XM_018054616.1
PRKAA2 F: TTGATGATGAGGTGGTGGAG
R: CCGTGAGAGAGCCAGAGAGT
138 XM_018044652.1
PRKAB1 F: CCACCACATCTCCTCCAAGT
R: GAGCACCATCACTCCATCCT
135 XM_013970630.2
PGC1α F: CCGAGAATTCATGGAGCAAT
R: GATTGTGTGTGGGCCTTCTT
184 XM_018049155.1
STK11 F: GGACACCTTCTCTGGCTTCA
R: CCCTTCCCGATGTTCTCAA
126 XM_018050463.1
ACTG1 F: ATGGCTACTGCTGCGTCGT
R: TTGAAGGTGGTCTCGTGGAT
161 XM_018063603.1