Skip to main content

Table 1 Primers used for Real-time PCR

From: Myricetin improves endurance capacity by inducing muscle fiber type conversion via miR-499

Gene Primer sequence Ta(°C)
Myh1 Forward GCGACAGACACCTCCTTCAAGAAC 60
Reverse CCAGCCAGCCAGCGATGTTG
Myh4 Forward CCATCACTGACGCCGCCATG 60
Reverse GTTCTTCTTCATCCGCTCCAGGTG
Myh7 Forward GAGCAGGAGCTGATCGAGAC 60
Reverse ATGGCCTTCTTGGCCTTCTC
Myh7b Forward CAACCTGGCTAAGTACCGCA 60
Reverse AATAAGGACAGGACAGCGGC
Myoglobin Forward CACCATGGGGCTCAGTGATG 60
Reverse CTCAGCCCTGGAAGCCTAGC
PGC-1α Forward GCAGCGGTCTTAGCACTCA 60
Reverse GACTGCGGTTGTGTATGGGA
Sox6 Forward TCCATGGCTTTGTCACTTTCA 60
Reverse ATACACGAGGATCACCCCAG
GAPDH Forward ACGGGAAGCTCACTGGCATGG 60
Reverse CGCCTGCTTCACCACCTTCTT