Skip to main content

Advertisement

Table 1 Primer sequences in qRT-PCR

From: Caprylic acid suppresses inflammation via TLR4/NF-κB signaling and improves atherosclerosis in ApoE-deficient mice

Gene Sense primer (5′-3′) Antisense primer (5′-3′) Accession No.
TLR4 TCAGTTCTCACCTTCCTCCTG GTTCATTCCTCACCCAGTCTTC GQ_503242.1
MyD88 GATGGTAGCGGTTGTCTCTGAT GATGCTGGGGAACTTTCTTC AB292176.1
NF-κB AGTACCCTGAGGCTATAACTCGC TCCGCAATGGAGGAGAAGTC EU399817.1
TNF-α TCCAATGGCAGAGTGGGTATG AGCTGGTTGTCTTTCAGCTTCAC NM_214022.1
TAK1 GAAGGTGGATCCCTGCACAA CATGCAAATATGCCAGGCCC XM_002101880.2
MAPK GCTGAAGCGCCATTCAAGTT CCTCTGAGCCCTTGTCCAAT NM_001357115.1
IKKα GGCTGGACAGCGTCTCTTTA GGTGGAAGATGGAGCCAGAC NM_001044308.2
IKKβ GTGCCTGTGACAGCTTACCT ACTGCGTTTGCACTTTTGCT NM_010546.2
β-Actin TGAGCTGCGTTTTACACCCT GCCTTCACCGTTCCAGTTTT NM_007393.5
  1. TLR4 toll-like receptor 4, MyD88 myeloid differentiation primary response 88, NF-κB nuclear factor kappa B, TNF-α tumor necrosis factor alpha, TAK1 TGF-β-activated kinase 1, MAPK mitogen-activated protein kinase, IKKα inhibitor kappa B kinase α, IKKβ inhibitor kappa B kinase β