Skip to main content

Table 1 Primers sequence used in the paper

From: A novel peptide RIFV suppresses human adipocyte differentiation through the inhibition of C/EBP-β expression

 DirectionSequence(5′-3′)
hC/EBP-αForwardTGGACAAGAACAGCAACGAG
ReverseTTGTCACTGGTCAGCTCCAG
hC/EBP-βForwardGACAAGCACAGCGACGAGTA
ReverseAGCTGCTCCACCTTCTTCTG
hPPAR-γForwardGCTGTGCAGGAGATCACAGA
ReverseGGGCTCCATAAAGTCACCAA
mC/EBP-αForwardTGCGCAAGAGCCGAGATAAA
ReverseCCTTCTGTTGCGTCTCCACG
mC/EBP-βForwardAGCGGCTGCAGAAGAAGGT
ReverseGGCAGCTGCTTGAACAAGTTC
mPPAR-γForwardGTGCCAGTTTCGATCCGTAGA
ReverseGGCCAGCATCGTGTAGATGA
mATGLForwardTTCACCATCCGCTTGTTGGAG
ReverseAGATGGTCACCCAATTTCCTC
mFABP4ForwardAAGGTGAAGAGCATCATAACCCT
ReverseTCACGCCTTTCATAACACATTCC