Skip to main content

Table 1 Sequence of primers used for quantitative real-time PCR

From: High levels of dietary methionine improves sitagliptin-induced hepatotoxicity by attenuating oxidative stress in hypercholesterolemic rats

Target geneSequence
Cypa
 ForwardTATCTGCACTGCCAAGACTGAGTG
 ReverseCTTCTTGCTGGTCTTGCCATTCC
Nox2
 ForwardCTCTGCCTCCATTCTCAAGTC
 ReverseGCGAACCACTCAAAAGCATG
Lox1
 ForwardCCCACAAGTCACAGACTCTTC
 ReverseCACACACTCACACACACAAATAC
Inos
 ForwardGGAGCAGGTTGAGGATTACTTC
 ReverseTCAGAGTCTTGTGCCTTTGG
Cd36
 ForwardGGCGATGAGAAAGCAGAAATG
 ReverseCACTACTCCAACACCAAGTAAGA
Klf2
 ForwardACTTGCAGCTACACCAACTG
 ReverseCTGTGACCCGTGTGCTTG
Tgfb
 ForwardAGAGCCCTGGATACCAACTA
 ReverseCAACCCAGGTCCTTCCTAAAG
Tlr4
 ForwardGGAAAAGCCTTGAATCCAGATG
 ReverseAGCAGAAACCCAGATGAACTG
Tlr2
 ForwardATGAACACTAAGACATACCTGGAG
 ReverseCAAGACAGAAACAGGGTGGAG
a-Sma
 ForwardGCTCCTCCAGAACGCAAATA
 ReverseCAGCTTCGTCATACTCCTGTTT
Mmp9
 ForwardCTTGAAGTCTCAGAAGGTGGATC
 ReverseCGCCAGAAGTATTTGTCATGG
Timp1
 ForwardCCACCTTATACCAGCGTTATGAG
 ReverseGGTTCTGGGACTTGTGGAC