Skip to main content

Table 1 The primer sequences

From: Resistant dextrin improves high-fat-high-fructose diet induced insulin resistance

Primer Sequences (5′ to 3′)
β-actin-F GTGCTATGTTGCTCTAGACTTCG
β-actin-R ATGCCACAGGATTCCATACC
PPARα-F CACGCATGTGAAGGCTGTAA
PPARα-R GCTCCGATCACACTTGTCG
CPT1A-F AACCCAGTGCCTTAACGATG
CPT1A-R GAACTGGTGGCCAATGAGAT
FXR-F TTCCTCAAGTTCAGCCACAG
FXR-R TCGCCTGAGTTCATAGATGC
ACOX-F TAACTTCCTCACTCGAAGCCA
ACOX-R AGTTCCATGACCCATCTCTGTC