Skip to main content

Table 2 Primer sequences used for real-time polymerase chain reaction

From: Gypenosides regulate farnesoid X receptor-mediated bile acid and lipid metabolism in a mouse model of non-alcoholic steatohepatitis

Gene Gene ID Forward primer (5′ to 3′) Reverse primer (5′ to 3′)
FXR 20186 CAGATTTCCTCCTCGTCTTAC CCTGAGTTCATAGATGCCA
SHP 23957 TTCCTTGCTTTGGATACAGTG GAGGTTTGGGGAGTCATCA
SREBP1 20787 GGCTTGGTGATGCTATGTTGA GGCAAAGGAACAACTGAGACC
FASN 14104 GTGTGGTGGGTT TGG TGA AT AGATGTGTTGCT GAG GTT GGA
SCD1 20249 TGAGGG GCA GTG TCT GTA A GGAAACTAAAGCAATGGA TGG
PPARα 19013 GAGGATGGGGACTTTTGTTCT GGC TTT TTG GCT GTA GGA GG
CPT1 12894 ACC CAG TCA GAT TCC AAC C ACAAAGCACCCA TTA CTT GAG
MTTP 17777 CCACCAGAATCGTAAGGTTCA GGACAGCAGGAT GTT CTT CAC
CYP7A1 13122 GTACCTTGATGAAAGTGGGAA ATTGCT TGA TTT CTT GGA CAG
FGFR4 14186 CCT TCT GTT CCA GCC TTA TG TTC TCT GAG GAT GAG TCC AAG
BSEP 27413 AAT GTT CAG TTC CTC CGT TC GTC CCC ATA CTT GAT GTT GTC
NTCP 20493 GTCATCAATGTGGGCAACAGC A TGAAAGGCATCAGGGAGGAGG TA
KLB 83379 CCT TCT GTT CCA GCC TTA TG TTC TCT GAG GAT GAG TCC AAG
FGF15 14170 GAAGCCAGA AGG TAT GAA GTC CCA AGT TTG TAA CCC CAG T
β-Actin 81822 CCT CTA TGC CAA CAC AGT AGC CAC CAA TCC ACA CAG
LPL 16956 CGA GAGCGAGAA CAT TCC CT TGT CCA CCT CCG TGT AAA TCA A
  1. FXR farnesoid X receptor, SHP small heterodimer partner, SREBP1 sterol-regulatory element-binding protein 1, SCD1 stearyl coenzyme A desaturation enzyme 1, FASN fatty acid synthetase, PPARα peroxisome proliferator-activated receptor alpha, CPT1 carnitine palmitoyl transferase 1, MTTP microsomal triglyceride transfer protein, CYP7A1 cholesterol 7-alpha hydroxy-lase, FGFR4 fibroblast growth factor receptor 4, BSEP bile salt export protein, NTCP, Na+-taurocholate co-transporting polypeptide, KLB Klotho beta, FGF15 fibroblast growth factor 15, LPL lipoprotein lipase