Skip to main content

Table 1 Primers for real time PCR assays

From: High fat diet significantly changed the global gene expression profile involved in hepatic drug metabolism and pharmacokinetic system in mice

Gene Forward primers Reverse primers
Cyp7a1 GAGCCCTGAAGCAATGAAAG GCTGTCCGGATATTCAAGGA
Cyp8b1 GGACAGCCTATCCTTGGTGA GACGGAACTTCCTGAACAGC
Cyp4a10 AATGGGAACGGCTGGCTGA TGGCCAAGCGGCCATTGGAA
Cyp4a14 GGCGAAAGAAAGTCAGGTT AGGCAGTGTTCAGTTGGA
Cyp4a31 AATGGGAACGGCTGGCTGGT TGGACAAGCGGCCATTGGA
Cyp2c70 TGGAGCCGGAACAGAGACAACGA ACGGCATGTGGTTCCTGTCCTGCA
Cyp3a59 CAGGCTAGAAAGGGTCTCAAAA AGTTTCATGCTGATGAGAGCAA
Gsta3 AGGAGTGGCGGATCTGGAGA CGGGTCCAGCTCTTCCACAT
Gstm6 GCCATGGTTTGCAGGGGACA TGGAAGGAAGCGGCTGGTCT
Gstm7 CCATGGTTCGCAGGGGACAA TTGCTGCCCCAAGTTGCCA
Nat8f1 ACAGCATCGAGGACAGGGGA GCCTGCCTTCTTGAAGCCCA
Slc22a30 GGAAGTATTATTTGTCTCCCATCG AGGATCCTACTGCCATTATCAGAG
Slc22a5 ACGAAGCCTCAGTTGCACCA ACAACAGCCAGGCCAGCACA
Slc30a10 GACTTTCATTTGCTGTGCTGAG GTGACAGGACATAAGGCAATGA
Slc4a4 CTTACAGAATCCCCAAGACTGG AAGTTGCATAGGAAAAGGGACA
Slco1a4 TACACGCTGGGTCGGTGCTT TCGGATTGCAGGAGAGGCT
Ugt2b35 GCCCTTGCCCAGATTCCACA AGAGTCCATTCGCGCCACCA
Cyp3a11 TGCCTTGGCATGAGGTTTGC TGACTGCATCCCGTGGCACA
Cyp2c70 TGGAGCCGGAACAGAGACAACGA ACGGCATGTGGTTCCTGTCCTGCA
Gapdh TGTGTCCGTCGTGGATCTGA CCTGCTTCACCACCTTCTTGA