Skip to main content

Table 1 Primers of all genes for qRT-PCR are listed

From: Early leucine programming on protein utilization and mTOR signaling by DNA methylation in zebrafish (Danio rerio)

  Sequence 5′-3′ Tm (°C)
accα F: GTGGAAACAAAGTTATTGAGAAGG 55
R: GTAAGCCCAGCGTCGGA
cpt1 F: ATCAGCACTGTTGAGCGAAG 59
R: CACTCCCTCCCTACTTATCTCC
cs F: TTCGCTCGGGCGTATTCT 59
R: GCTGCTGCCTTCACGGTAT
fas F: GATGGACGAGTGCTTTACCC 55
R: ATGGTGGCTCTATGGATGGT
got F: GCTAAAGGCTTACACCTACTAT 56
R: GTCAAAGAACACCAGGAGAT
gpt F: AGAAGACCCTGACGATGGAC 56
R: GAGGAAGGTGATTGGTTGCT
Pfk1 F: AACGAACTCTTCCAAACTCCTG 55
R: GACTCCTTCATACGCCTCAAAT
mtor F: GCCGCTTTGCCAACTATTT 55
R: TCGTCTGCCTTCATTCCTG
leptinA F: ATTCCCGCTGACAAACCC 56
R: GTAACCCAGAAGTGTGGATAGATC
leptinB F: CCCCGTCACCTCCAACTACCT 59
R: CAGAGAATGAATGTCTCAGCCACA
grb10 F: TCCGAACCCTTTCCCTGAG 60
R: CTTCCACAACTTTTCCCACA
wdr24 F: TTACTGAGCGGCAAACCC 57
R: TGATTCGCAGCATCGTCC
eif4e F: AGTGATGATGTCTGTGGTGCTG 61
R: TGTTCTCGTAGTCTGTCGTCC
β-actin F: CACCTTCCAGCAGATGTGGA 58
R: AAAAGCCATGCCAATGTTGTC