Skip to main content

Table 2 Primers used in Luciferase activity assay

From: MicroRNA-302a is involved in folate deficiency-induced apoptosis through the AKT-FOXO1-BIM pathway in mouse embryonic stem cells

Sequence position Primer
M-Bim-3′UTR -F 5′CCGCTCGAGTCAGCCCAGGGTATCTTCAAGTG3'
M-Bim-3′UTR -R 5′GAATGCGGCCGCTACAGCATTATGAAACAGTAGG3'
M-Bim-mut1-F 5′ GAGTAAACGAGTTGTCTTCCACAAGATGTCTG 3'
M-Bim-mut1-R 5′ GAAGACAACTCGTTTACTCGGCATAATGGAAG 3'
M-Bim-mut2-F 5′ TGGAGGACGAGTTTCTAACCTGTGGAGAGCTG 3'
M-Bim-mut2-R 5′ AGGTTAGAAACTCGTCCTCCACCAGGCTGTGC 3'
M-Bim-mut3-F 5′ GACTGGACGAGTTTACTGTCTCAGCCCCATGG 3'
M-Bim-mut3-R 5′ GACAGTAAACTCGTCCAGTCGGGGAGACTGGC 3'
\