Skip to main content

Table 1 Primers for real-time PCR detection in mice

From: Changes in hepatic triglyceride content with the activation of ER stress and increased FGF21 secretion during pregnancy

Gene GenBank ID Primer sequence (5′ – 3′)
SCD1 20,249 Forward AAGATATTCACGACCCCACC
Reverse CAGCCGTGCCTTGTAAGTTC
ACC1 107,476 Forward GCTTATTGATCAGTTATGTGGCC
Reverse CTGCAGGTTCTCAATGCAAA
FASN 14,104 Forward GTCCTGGGAGGAATGTAAACAG
Reverse CGGATCACCTTCTTGAGAGC
CD36 12,491 Forward AAGCAAAGTTGCCATAATTGAGTC
Reverse GGAAAGGAGGCTGCGTCTG
FABP1 14,080 Forward TCAAGCTGGAAGGTGACAATAA
Reverse GTCTCCATTGAGTTCAGTCACG
FATP2 26,458 Forward CGAGACGAGACGCTCACCTA
Reverse ACGAATGTTGTAGTTGAGGCAC
FATP5 26,459 Forward TCTATGGCCTAAAGTTCAGGCG
Reverse CTTGCCGCTCTAAAGCATCC
MTP 17,777 Forward TGGTGAAAGGGCTTATTCTGTT
Reverse TTGCAGCTGAATATCCTGAGAA
ApoB 238,055 Forward AAACATGCAGAGCTACTTTGGAG
Reverse TTTAGGATCACTTCCTGGTCAAA
PPARα 19,013 Forward AAGGGCTTCTTTCGGCGAAC
Reverse TGACCTTGTTCATGTTGAAGTTCTTCA
CPT1α 12,894 Forward TTGGGCCGGTTGCTGAT
Reverse GTCTCAGGGCTAGAGAACTTGGAA
Hadha 97,212 Forward TGCATTTGCCGCAGCTTTAC
Reverse GTTGGCCCAGATTTCGTTCA
ACOX1 11,430 Forward TAACTTCCTCACTCGAAGCCA
Reverse AGTTCCATGACCCATCTCTGTC
Acaa1b 235,674 Forward CAGGACGTGAAGCTAAAGCCT
Reverse CTCCGAAGTTATCCCCATAGGAA
Ech1 51,798 Forward GCTACCGCGATGACAGTTTC
Reverse GCTCAGAGATCGAAGGCTGATG
Ehhadh 74,147 Forward ATGGCTGAGTATCTGAGGCTG
Reverse ACCGTATGGTCCAAACTAGCTT
MLycd 56,690 Forward GCACGTCCGGGAAATGAAC
Reverse GCCTCACACTCGCTGATCTT
FGF21 56,636 Forward AGGATGGAACAGTGGTAGGCG
Reverse GGCTTTGACACCCAGGATTTG
KLB 83,379 Forward TCCCCTGTGATTTCTCTTGG
Reverse GAGCAATCTGTTGCCAGTGA
FGFR1 14,182 Forward CGCTCTACCTGGAGATCATT
Reverse ATAAAGAGGACCATCCTGTG
FGFR2 14,183 Forward CACCAACTGCACCAATGAAC
Reverse GGCTGGGTGAGATCCAAGTA
FGFR3 14,184 Forward CATCCGGCAGACATACACAC
Reverse TTCACTTCCACGTGCTTCAG
FGFR4 14,186 Forward TAATGTTGGCAGTGTCAGGCCTCT
Reverse TGGGAGCATAAGGCTGGAACAGAA
Yipf6 77,929 Forward TGTCAATTTCTCAGGACATTCCC
Reverse CTCGCATAATGGTCCGACGA
Yipf5 67,180 Forward GGCTTTGATAACTTAAACAGCGG
Reverse GTCACAGCCAGCATACTGCTT
Sar1a 20,224 Forward GATTGGACAATGCGGGCAAAA
Reverse TCTGAAGTGGGATGGAGTGTT
Sec23a 20,334 Forward AGATGGGGTCCGGTTCAGTT
Reverse GGTAGGTCGGGTCTCTCCTT
Sec24a 77,371 Forward CCACAAGTGTCATCGAGTCAA
Reverse AGAACCACCGTAGTTCGACTG
Sec31a 69,162 Forward TGAACAGAGTGCCGAAGAAGA
Reverse TGGTGACGTAATGGGAACAGG
Sec13 110,379 Forward TGAACACTGTGGACACCTCTC
Reverse TTGACGGACCTATCCGAGGAG
β-actin 11,461 Forward ACCCCAGCCATGTACGTAGC
Reverse GTGTGGGTGACCCCGTCTC