Skip to main content

Table 1 Primers used for reverse transcription and real-time PCR

From: Asiatic acid alleviates Ang-II induced cardiac hypertrophy and fibrosis via miR-126/PIK3R2 signaling

Primer names   Sequences
ANP Sense
Anti-sense
CCTTCTCCATCACCAA
TGTTATCTTCGGTACCG
PIK3R2 Sense
Anti-sense
ACTCACCTTCTGCTCCGTT
TCTGGTCCTGCTGGTATTTGG
U6 Stem-loop
Sense
Anti-sense
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAA
AGAGAAGATTAGCATGGCCCCTG
ATCCAGTGCAGGGTCCGAGG
miR-126 Stem-loop
Sense
Anti-sense
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCATT
CGCGTCGTACCGTGAGTAAT
AGTGCAGGGTCCGAGGTATT
pri-miR-126 Sense
Anti-sense
AAGGACCATTGTTGGCACTCAGG
TCTCACCACGCTGTCCACTCC
β-MHC Sense
Anti-sense
GCCGAGTCCCAGGTCAACAA
GTAATTCGAGGGCAGGAACCC
Co1 I Sense
Anti-sense
ACTCAGCCCTCTGTGCCT
CCTTCGCTTCCATACTCG
Co1 III Sense
Anti-sense
AGATGCTGGTGCTGAGAAG
TGGAAAGAAGTCTGAGGAAGG
GAPDH Sense
Anti-sense
GACATCAAGAAGGTGGTGAAGC
TGTCATTGAGAGCAATGCCAGC