Skip to main content

Table 1 Primer sequences

From: The anti-diabetic effects of betanin in streptozotocin-induced diabetic rats through modulating AMPK/SIRT1/NF-κB signaling pathway

Gene Sequence
AMPK F. 5′AGATAGCTGACTTCGGACTCTCT3′
R. 5′AACCTCAGGACCCGCATACA3′
NF-κB F. 5′AGAGCAACCGAAACAGAGAGG3′
R. 5′TTTGCAGGCCCCACATAGTT3′
SIRT1 F. 5′TGGACGAGCTGACCCTTGA3′
R. 5′TCCTGCGGATGTGGAGATT3′
β-actin F. 5′TCACCCACACTGTGCCCATCTATGA3′
R. 5′CATCGGAACCGCTCATTGCCGATAG3′