Skip to main content

Table 1 Primer sequences used for mRNA quantification by RT-qPCR

From: Dietary curcumin supplementation promotes browning and energy expenditure in postnatal overfed rats

  Forward primer 5’–3’ Reverse primer 5’–3’
UCP1 ACTGTACAGAGCTGGTGACA TGGTAGAGAGTTGATGAATCTCGT
PGC1α GTGGATGAAGACGGATTGCC TTCTGAGTGCTAAGACCGCT
PRDM16 GGACAGTGACAGAGACAAAAGC CTGTGAATAGAAGGCCGGTA
TMEM26 TTGCCATGGGCTAGAATCCG TAAAGGCCTGTGCAGCTACC
PPARγ ATCAGGTTTGGGCGAATG TTTGGTCAGCGGGAAGGA
β3-AR TGCTGTTCCTTTGCCTCCAA TAGCTACGACGAACACTCGA
GAPDH GGCTCTCTGCTCCTCCCTGTTCTA CGTCCGATACGGCCAAATCCGT
  1. UCP1 uncoupling protein 1, PGC1α peroxisome proliferator-activated receptor γ coactivator-1α, PRDM16 positive regulatory domain containing 16, TMEM26 transmembrane protein 26, PPARγ peroxisome proliferator-activated receptor γ, β3-AR β3-adrenergic receptor, GAPDH glyceraldehyde-3-phosphate dehydrogenase