Skip to main content

Table 2 List of 15 genes and 27 SNPs studied for association with weight loss induced by a low CHO diet.

From: Physiogenomic analysis of weight loss induced by dietary carbohydrate restriction

Gene Family or Pathway Gene SNP N mac min maj Freq Gene Description Sequence Context
Lipases Hepatic lipase rs936960 49 7 A C 0.07 LIPC lipase, hepatic CAGAGCACGAGGCTGATTTTC [A/C]ATCCCAGTGTGGGCCACACC
   rs417344 50 13 T C 0.13 LIPC lipase, hepatic TTTCCTAATTTTGCAGTTGAG [A/G]TTTAAGAGGTTGGGAACTGG
   rs6083 39 28 A G 0.36 LIPC lipase, hepatic GTCTTTCTCCAGATGATGCCA [A/G]TTTTGTGGATGCCATTCATA
  Lipoprotein lipase rs295 46 15 A C 0.16 LPL lipoprotein lipase GATGCACCTACTAGACACCTA [A/C]TCTGCGCTAGATGGTGGGGG
   rs328 53 10 C G 0.09 LPL lipoprotein lipase ACAAGTCTCTGAATAAGAAGT [C/G]AGGCTGGTGAGCATTCTGGG
  Hormone sensitive lipase rs10422283 43 26 T C 0.30 LIPE lipase, hormone-sensitive GGAAGGAACCTCGTACATCCT [A/G]CGGGGCAGTGGGGACAGCGT
  Lysosomal acid lipase rs1556478 35 28 A G 0.40 LIPA lipase A, lysosomal acid, cholesterol esterase (Wolman disease) CACGGAGACTTATGCACCAGA [A/G]TGAAATGCTGAGATGTTCTT
   rs6586179 45 7 T C 0.08 LIPA lipase A, lysosomal acid, cholesterol esterase (Wolman disease) ACCCTGCATTCTGAGGGGTCT [A/G]GAGGGAAACTGACAGCTGTG
  Endothelial lipase rs4245232 45 15 A C 0.17 LIPG lipase, endothelial TAAAAAACTAAAGCCCGCCTG [A/C]GTCTTGTTAATGAATGATAG
  Gastric lipase rs814628 45 9 A G 0.10 LIPF lipase, gastric ATCGACTTCATTGTAAAGAAA [A/G]CTGGACAGAAGCAGCTACAC
Glycogen Synthases Glycogen Synthase 1 (muscle) rs2287754 35 16 A G 0.23 GYS1 glycogen synthase 1 (muscle) CGGGAAGCTTGCAAGACGCTC [A/G]GCTTCCTATTGCAAGACCGC
  Glycogen Synthase 2 (hepatic) rs1478290 59 29 T G 0.25 GYS2 glycogen synthase 2 (liver) AATGTGGCTGAAGCCAAAAGC [A/C]TAATGAATGAGGGGAAGCCT
   rs1871143 40 23 T G 0.29 GYS2 glycogen synthase 2 (liver) AGCCAGGAGCTTTCCTGGGCG [A/C]TTTTTGTACAGGATCTCATT
   rs2306179 44 18 A G 0.20 GYS2 glycogen synthase 2 (liver) TTTCAGTAGGTTTGCAGGGAA [A/G]CCAACTCAAAGCTATATCTG
  Glycogen Synthase 3b rs4688046 44 19 T C 0.22 GSK3B glycogen synthase kinase 3 beta TAGTAAACTATTTCTTCCCAT [A/G]GGAGAAGATGGATTCTTTTC
   rs334555 43 7 C G 0.08 GSK3B glycogen synthase kinase 3 beta AATTATATCTTATTATTAAAA [C/G]TCTACCAACTCAAAGCTTCC
HDL Homeostasis CETP rs711752 46 36 A G 0.39 CETP cholesteryl ester transfer protein, plasma TTCAAGGTCAAGTTCTTTGGT [A/G]AGAAGGTCCTAGCTGCATTG
   rs3764261 41 20 T G 0.24 CETP cholesteryl ester transfer protein, plasma AGTGAATGAGATAGCAGACAA [A/C]CCAGATGCCTACCGACAGGT
   rs5880 44 4 C G 0.05 CETP cholesteryl ester transfer protein, plasma GATATCGTGACTACCGTCCAG [C/G]CCTCCTATTCTAAGAAAAGC
   rs1532624 51 33 T G 0.32 CETP cholesteryl ester transfer protein, plasma TCTGCCCCTTTGGGCTGCAGC [A/C]TCACAAGCTGTGTGGCGTTG
   rs5883 56 8 T C 0.07 CETP cholesteryl ester transfer protein, plasma AGCTACCTTGGCCAGCGAGTG [A/G]AAGACTCGCTCAGAGAACCA
  APOA1 rs5070 41 18 A G 0.22 APOA1 apolipoprotein A-I GCCACGGGGATTTAGGGAGAA [A/G]GCCCCCCGATGGTTGGCTCC
  APOC3 rs4520 38 23 T C 0.30 APOC3 apolipoprotein C-III CTTGGTGGCGTGCTTCATGTA [A/G]CCCTGCATGAAGCTGAGAAG
   rs2071521 45 37 T C 0.41 APOC3 apolipoprotein C-III ACAGCTCCTGTTGCCATAGGA [A/G]GGAGCTGGGTGAGATACTAG
Appetite Hormones Galanin rs694066 56 6 A G 0.05 GAL galanin TTCTAAGTCCTCTGCCATGCC [A/G]GGAAAGCCTGGGTGCACCCA
  Neuro-peptide Y rs1468271 48 5 A G 0.05 NPY neuropeptide Y GACCCTGTAATTTTCAGAAAC [A/G]CACATAGGAGTGGGTGTCTG
  Ghrelin Precursor rs26312 63 14 A G 0.11 GHRL ghrelin precursor GCTGTTGCTGCTCTGGCCTCT [A/G]TGAGCCCCGGGAGTCCGCAG
  1. SNP identification numbers (noted as "rs...") are the unique SNP identifiers from the NCBI dbSNP database. Also given are the number of patients with good genotype results (N), the number of minor alleles found (mac), and the corresponding allele frequency as observed in this study.